ID: 1023888126

View in Genome Browser
Species Human (GRCh38)
Location 7:44375171-44375193
Sequence CCTCTGAGGGGACCCTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023888109_1023888126 18 Left 1023888109 7:44375130-44375152 CCCCACTCTCCTTTCTCATCCAT No data
Right 1023888126 7:44375171-44375193 CCTCTGAGGGGACCCTCCCAGGG No data
1023888108_1023888126 25 Left 1023888108 7:44375123-44375145 CCAGGGTCCCCACTCTCCTTTCT No data
Right 1023888126 7:44375171-44375193 CCTCTGAGGGGACCCTCCCAGGG No data
1023888106_1023888126 27 Left 1023888106 7:44375121-44375143 CCCCAGGGTCCCCACTCTCCTTT No data
Right 1023888126 7:44375171-44375193 CCTCTGAGGGGACCCTCCCAGGG No data
1023888107_1023888126 26 Left 1023888107 7:44375122-44375144 CCCAGGGTCCCCACTCTCCTTTC No data
Right 1023888126 7:44375171-44375193 CCTCTGAGGGGACCCTCCCAGGG No data
1023888112_1023888126 9 Left 1023888112 7:44375139-44375161 CCTTTCTCATCCATGTCTCCAGG No data
Right 1023888126 7:44375171-44375193 CCTCTGAGGGGACCCTCCCAGGG No data
1023888115_1023888126 -1 Left 1023888115 7:44375149-44375171 CCATGTCTCCAGGGCCCTCTCCC No data
Right 1023888126 7:44375171-44375193 CCTCTGAGGGGACCCTCCCAGGG No data
1023888111_1023888126 16 Left 1023888111 7:44375132-44375154 CCACTCTCCTTTCTCATCCATGT No data
Right 1023888126 7:44375171-44375193 CCTCTGAGGGGACCCTCCCAGGG No data
1023888105_1023888126 28 Left 1023888105 7:44375120-44375142 CCCCCAGGGTCCCCACTCTCCTT No data
Right 1023888126 7:44375171-44375193 CCTCTGAGGGGACCCTCCCAGGG No data
1023888116_1023888126 -9 Left 1023888116 7:44375157-44375179 CCAGGGCCCTCTCCCCTCTGAGG No data
Right 1023888126 7:44375171-44375193 CCTCTGAGGGGACCCTCCCAGGG No data
1023888110_1023888126 17 Left 1023888110 7:44375131-44375153 CCCACTCTCCTTTCTCATCCATG No data
Right 1023888126 7:44375171-44375193 CCTCTGAGGGGACCCTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023888126 Original CRISPR CCTCTGAGGGGACCCTCCCA GGG Intergenic
No off target data available for this crispr