ID: 1023888130

View in Genome Browser
Species Human (GRCh38)
Location 7:44375188-44375210
Sequence CTGGGCTTAGTTTGGGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023888130_1023888134 -10 Left 1023888130 7:44375188-44375210 CCAGGGACCCAAACTAAGCCCAG No data
Right 1023888134 7:44375201-44375223 CTAAGCCCAGCCTGCTCCCCGGG No data
1023888130_1023888137 -2 Left 1023888130 7:44375188-44375210 CCAGGGACCCAAACTAAGCCCAG No data
Right 1023888137 7:44375209-44375231 AGCCTGCTCCCCGGGCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023888130 Original CRISPR CTGGGCTTAGTTTGGGTCCC TGG (reversed) Intergenic
No off target data available for this crispr