ID: 1023890883

View in Genome Browser
Species Human (GRCh38)
Location 7:44391246-44391268
Sequence GGACATGCCCCTGGTGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 173}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023890876_1023890883 8 Left 1023890876 7:44391215-44391237 CCCCACCTTAACTGTGTGTACTA 0: 1
1: 0
2: 1
3: 6
4: 107
Right 1023890883 7:44391246-44391268 GGACATGCCCCTGGTGTGGCAGG 0: 1
1: 0
2: 0
3: 15
4: 173
1023890877_1023890883 7 Left 1023890877 7:44391216-44391238 CCCACCTTAACTGTGTGTACTAA 0: 1
1: 0
2: 1
3: 6
4: 94
Right 1023890883 7:44391246-44391268 GGACATGCCCCTGGTGTGGCAGG 0: 1
1: 0
2: 0
3: 15
4: 173
1023890879_1023890883 3 Left 1023890879 7:44391220-44391242 CCTTAACTGTGTGTACTAAGTGC 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1023890883 7:44391246-44391268 GGACATGCCCCTGGTGTGGCAGG 0: 1
1: 0
2: 0
3: 15
4: 173
1023890878_1023890883 6 Left 1023890878 7:44391217-44391239 CCACCTTAACTGTGTGTACTAAG 0: 1
1: 0
2: 1
3: 15
4: 126
Right 1023890883 7:44391246-44391268 GGACATGCCCCTGGTGTGGCAGG 0: 1
1: 0
2: 0
3: 15
4: 173
1023890875_1023890883 16 Left 1023890875 7:44391207-44391229 CCAGTCAACCCCACCTTAACTGT 0: 1
1: 0
2: 2
3: 8
4: 118
Right 1023890883 7:44391246-44391268 GGACATGCCCCTGGTGTGGCAGG 0: 1
1: 0
2: 0
3: 15
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023890883 Original CRISPR GGACATGCCCCTGGTGTGGC AGG Intronic
900315807 1:2055809-2055831 GGACCTGCCCAGGGTGGGGCAGG - Intronic
901344128 1:8523820-8523842 GTTCCTGCCACTGGTGTGGCTGG - Intronic
902863493 1:19262261-19262283 GGCCATGGCCCTGGTGGAGCAGG - Intergenic
903193235 1:21668320-21668342 GGTCAGGCCCCTGGGGCGGCAGG - Intronic
903570133 1:24298073-24298095 GAACTTGCCCCTGGTGAGGCAGG + Intergenic
909113796 1:71509435-71509457 CGACATGCCACTGGTGAGTCAGG + Intronic
911084134 1:93962561-93962583 TGCAATGCCCCTGGTGTGGAAGG + Intergenic
913657412 1:120974565-120974587 GTACAGGTCCCTGGTGTGTCAGG + Intergenic
914954899 1:152153098-152153120 GGCCAAGTCCTTGGTGTGGCTGG + Intergenic
915355750 1:155254582-155254604 GGACTTGCAGCTGGTGTGGAGGG + Intronic
915738017 1:158096797-158096819 GGACATGCAGCTGGGGAGGCGGG - Intronic
916426802 1:164688608-164688630 GGTCATGGCCCTGGTGTGAGTGG - Intronic
917534955 1:175867817-175867839 GGACACCTCCCTGGTGTGTCAGG + Intergenic
919931925 1:202226664-202226686 GGACATTCCCTGGGGGTGGCAGG - Intronic
922568793 1:226619431-226619453 GGACATGCTATTGGTCTGGCTGG - Intergenic
924199195 1:241641364-241641386 GGACAGGCTGCAGGTGTGGCTGG - Intronic
1063862492 10:10326663-10326685 GGCCATGCCCCACGTGTGGATGG - Intergenic
1064137112 10:12760697-12760719 GGACAGAACCCAGGTGTGGCTGG + Intronic
1067017462 10:42768846-42768868 GGAGATGCCCCTGCTCTGTCAGG - Intergenic
1067708359 10:48627789-48627811 GGCCCGGCCTCTGGTGTGGCTGG + Intronic
1069936885 10:71923674-71923696 GGACAAGCCATTGGTGTGTCTGG + Intergenic
1071464300 10:85925484-85925506 GGACACGGCCCTGGGGTGGCAGG + Intronic
1072434852 10:95405655-95405677 GTAGATGCCCCTGGGGTGGTGGG - Intronic
1072565882 10:96616177-96616199 GCCCATGCCCCAGGTGTAGCAGG - Intronic
1073352171 10:102827783-102827805 TGACCTGACCCTGGTCTGGCTGG + Intergenic
1075714483 10:124548194-124548216 GGAAATGGCTCTGGAGTGGCCGG - Intronic
1076846888 10:133073684-133073706 GCACAGGCCCCAGGTGTGGCTGG + Intronic
1077139808 11:1019283-1019305 GGGCTTGTCCCTGATGTGGCTGG + Exonic
1077176821 11:1194923-1194945 GGACAGGACCCTGGTGTCTCAGG - Intronic
1077181296 11:1218375-1218397 CCAAATGCACCTGGTGTGGCTGG - Intergenic
1077533497 11:3108081-3108103 GGGCATGTCCCTGCTGGGGCAGG - Intronic
1078456201 11:11477374-11477396 GGAGATGCCCCTGCTGGGCCAGG - Intronic
1080948768 11:37004678-37004700 AGACATGGCCCTGTTGTGTCTGG - Intergenic
1081979510 11:47257781-47257803 GGAAATGCCACTGTTTTGGCCGG + Intronic
1082881226 11:58040402-58040424 GGACATGAACCAGGTCTGGCTGG + Intronic
1083619270 11:64040908-64040930 GGCCAGGCCCCAGGTGTGGCAGG + Intronic
1084062605 11:66685994-66686016 GGTCATGCCCCGGGTGGTGCTGG + Exonic
1084423353 11:69071512-69071534 GGCCAGGCCCCTGGTGGGACGGG + Intronic
1085417056 11:76326134-76326156 AGACCTGCCCCTGGGGTGGGTGG + Intergenic
1089602327 11:119623640-119623662 GGAAATGGTCCTGGGGTGGCAGG + Intronic
1089617390 11:119702556-119702578 GCAAATGCCCCTGGTGAGGTAGG - Intronic
1094840667 12:34341451-34341473 GTTCACGCCCCTGGAGTGGCTGG + Intergenic
1097288376 12:57894736-57894758 GGACAGGCCCCTGGTGGCACAGG + Intergenic
1103576034 12:121877848-121877870 GTACATGGGCCTGGTGTGGCCGG + Intergenic
1104462388 12:128966267-128966289 TGAAATGCCCCAGGGGTGGCTGG + Intronic
1104739786 12:131164182-131164204 GGACCTGCCCCAGGGCTGGCGGG - Intergenic
1106719024 13:32420005-32420027 GGACTTGGCCCTGGTGGGGTGGG - Intronic
1112132804 13:96542302-96542324 GGACATGCTCCTGGTGGGTAGGG + Intronic
1113463207 13:110496074-110496096 GGAGATGCCCCTGGTCAGGCTGG - Intronic
1113912850 13:113852469-113852491 GGACAGGAGCCTGGTCTGGCTGG + Intronic
1116379831 14:44251608-44251630 GGACATACCTCTGGTGGGGAAGG + Intergenic
1119261783 14:73241994-73242016 GGGCAGGCCCCAGGTGAGGCTGG + Intronic
1120026038 14:79585327-79585349 GGACATGCCACTTGTTTGGAAGG + Intronic
1121783789 14:96639648-96639670 GGCCCTGGCCTTGGTGTGGCAGG + Intergenic
1127996130 15:64153938-64153960 GGACAGGCCGCTGGTGCTGCTGG - Exonic
1132381542 15:101369864-101369886 GGACAGGCCCCTGCTGGTGCAGG + Intronic
1133110054 16:3542746-3542768 GGAAATGCCATTGGGGTGGCTGG - Exonic
1134515565 16:14884023-14884045 GGACATGCCCCTGCTCTAACAGG + Intronic
1137723723 16:50642920-50642942 GGACAAGCCCCTGCTGTCTCTGG + Intergenic
1138281367 16:55774356-55774378 GCACATGCGCGTGCTGTGGCAGG + Intergenic
1138415696 16:56870223-56870245 GGACCTGCTCCAGGTGAGGCCGG + Exonic
1138434722 16:56990947-56990969 GGACCTGCACATGGTGTGGACGG + Intronic
1138575431 16:57904442-57904464 GGAGAAGCCCCTGGTGTTTCTGG - Intronic
1138597310 16:58035896-58035918 GGCCAGGTCCCTGGTGTGGCTGG - Intronic
1139773528 16:69298229-69298251 GCAAATGCCCCAGGTGTGGTGGG - Intronic
1142057060 16:88004604-88004626 GCAGCTGCCCCTGGTGTGGCTGG - Intronic
1143166051 17:4897738-4897760 GTCCCTGCCCCTGGAGTGGCTGG - Exonic
1145028360 17:19486217-19486239 GCTCATGACCTTGGTGTGGCAGG + Intergenic
1145819103 17:27817648-27817670 AGAAATGCCCCCAGTGTGGCAGG - Intronic
1149993076 17:61393530-61393552 GGAGCTGCCCCAGGTCTGGCTGG - Intergenic
1152099494 17:78292700-78292722 GGACCTGCCCCTGATTTGGCCGG + Intergenic
1152602682 17:81272711-81272733 GGAGATGTGCCTGGTGTGCCTGG - Intronic
1153040293 18:806977-806999 GGACAAGACGCTGCTGTGGCTGG + Intronic
1153524242 18:5979613-5979635 AAAAATGCCCCTGGTGTGGTAGG - Intronic
1155149033 18:23107876-23107898 AGAAATGCCCCTGATGGGGCTGG + Intergenic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1160468822 18:79107820-79107842 GGACATGATACTGATGTGGCGGG + Intronic
1161136050 19:2620428-2620450 GGAGTGGCCCCTGGGGTGGCAGG - Intronic
1161533939 19:4807277-4807299 GGACATGCGGCTGGGGTGGGTGG + Intergenic
1161984472 19:7646168-7646190 GGGGCTGCGCCTGGTGTGGCTGG - Intronic
1164764833 19:30756450-30756472 GGACACGCCCAGGGTGGGGCTGG - Intergenic
1165318585 19:35072578-35072600 GGACTGGGCCCAGGTGTGGCAGG + Intergenic
1166108719 19:40610243-40610265 GGATAGGGCTCTGGTGTGGCAGG - Intronic
1167156213 19:47740976-47740998 GCTCATGCCCCTGCTGCGGCAGG + Exonic
1168410308 19:56135785-56135807 GGACCTGCTCCTGGTCAGGCAGG + Intronic
1168632903 19:57971350-57971372 GGACCTGGCCCTGGGGTGGTTGG - Intronic
925343956 2:3156910-3156932 GGAGCTGCTCCTGGTGTGGGTGG - Intergenic
926978108 2:18535083-18535105 AGACGTGGCCTTGGTGTGGCAGG - Intergenic
928688540 2:33775426-33775448 GGACCTGCACTTGGAGTGGCCGG + Intergenic
931088970 2:58865310-58865332 GGGCATGTCCATGGTGTGGGAGG - Intergenic
933194591 2:79373964-79373986 GGACAGTCTCCTGCTGTGGCTGG - Intronic
934276104 2:91574020-91574042 GGGCAGGCTCCTGGTGTGGAGGG + Intergenic
935171819 2:100616087-100616109 GGCCATGTCCCTGGTGGAGCTGG + Intergenic
938291914 2:130155035-130155057 GGGCCTGGCCCTGGTCTGGCTGG + Intronic
938464637 2:131517929-131517951 GGGCCTGGCCCTGGTCTGGCTGG - Intergenic
940330235 2:152466257-152466279 GGACATGCCCCTGATGGGTCTGG + Intronic
941314248 2:163972884-163972906 GGACATGCTCCTGTTGTGATGGG + Intergenic
943375269 2:187068654-187068676 GGAAAGTCCCCTGGTGTGACTGG + Intergenic
945508884 2:210675776-210675798 GGCCATGCCACTGGGGTGGCAGG - Exonic
948871280 2:240799451-240799473 GGACAAGTTCCTGATGTGGCTGG + Intronic
1171220535 20:23393105-23393127 GGAGATGGATCTGGTGTGGCTGG - Intronic
1174368019 20:50068131-50068153 CAACATGCCCCTGGTGAAGCGGG + Intergenic
1175829582 20:61954804-61954826 GGACATCCTCCTGGTGGCGCGGG + Intronic
1178298692 21:31432714-31432736 TGACATGCCCCTGCAGTGTCAGG + Intronic
1179886765 21:44317507-44317529 GGAAATGCCGCTGCTGTGACCGG + Intronic
1180247409 21:46557475-46557497 AATCATGCCCCTGTTGTGGCTGG + Intronic
1181721767 22:24780692-24780714 GGACATACCCCTGAGGTGTCAGG - Intergenic
1182556676 22:31133112-31133134 CGACATGCCACTGGTGCGGCTGG + Exonic
1183063096 22:35347343-35347365 GGAGCTGCCCCAGCTGTGGCTGG + Exonic
1183903098 22:41021140-41021162 GGACAGGGCCCTGGGCTGGCTGG + Intergenic
1184057032 22:42059567-42059589 GGAGCTGCCCCTGCTGTGCCTGG - Exonic
1184300937 22:43560583-43560605 GGACATGGCCCTGGTTGGGGTGG + Intronic
950879544 3:16312018-16312040 GGACATGCCGCTGTTGTGCAAGG + Intronic
953666400 3:44929182-44929204 GGTCAGGCCCCTGGTGTGCAGGG - Intronic
954708107 3:52491817-52491839 GAACCGGCCCCTGGTGGGGCTGG - Intronic
958803036 3:98778309-98778331 AGACATGCTCCTGGCCTGGCTGG - Intronic
960055944 3:113276432-113276454 GGACAGGCCCCTGCTGCGTCTGG + Intronic
961067199 3:123885318-123885340 GGAGAGGCTCCTGGGGTGGCTGG - Intergenic
961693699 3:128689092-128689114 GGACTTGCCACTGGTGTTGGGGG + Intergenic
964733727 3:159894375-159894397 GGAGTTGACCCTGGTGTGTCAGG + Intronic
968609170 4:1549336-1549358 GGACAGCCCCCAGGTGTGGTCGG + Intergenic
968808583 4:2790105-2790127 GGCCATGCCACTGATTTGGCAGG - Intergenic
969162983 4:5278090-5278112 TGACAGGCCCCAGGGGTGGCAGG + Intronic
969181566 4:5446066-5446088 AGACATGCCCCTGGAGGGGGTGG - Intronic
969478838 4:7436223-7436245 GGTCATACCCCAGGTGGGGCTGG + Intronic
976734411 4:88295903-88295925 AGACATGCCCCTGCTGCAGCGGG + Intergenic
982107316 4:152022282-152022304 GGCCATGCCCATCATGTGGCTGG + Intergenic
984618526 4:181926698-181926720 AGATATGGTCCTGGTGTGGCTGG + Intergenic
984862671 4:184254232-184254254 GAACAAGACCCTGGTGTGTCCGG - Intergenic
985551411 5:535251-535273 GGTCCTGCCCCTGGGGAGGCGGG - Intergenic
985682477 5:1263853-1263875 GGACAGGGCCATGGTGTGGGGGG - Intronic
986339191 5:6775018-6775040 GGAAAAGCCACTGATGTGGCGGG - Intergenic
987339758 5:16929247-16929269 GAACATGCCACTGATTTGGCCGG - Intronic
988018657 5:25595177-25595199 GGACATGCCCCTGGTCAAGGTGG - Intergenic
990341859 5:54831383-54831405 GACCAGGTCCCTGGTGTGGCAGG + Intergenic
998231015 5:140361392-140361414 GACCAAGACCCTGGTGTGGCAGG + Intronic
998491434 5:142550534-142550556 GGAAATGCTCCTGGTCTGGAGGG + Intergenic
999193212 5:149763974-149763996 GGAAAAGCCCCAGGAGTGGCTGG - Intronic
1002456046 5:179345746-179345768 GGTTGTGCCCCTGGGGTGGCTGG - Intergenic
1002469791 5:179428548-179428570 GGACAGGGCCCTGGTGGGCCAGG - Intergenic
1002772204 6:299790-299812 GCCCATGCCACAGGTGTGGCCGG + Intronic
1003276826 6:4660786-4660808 GGGCGTGCCCCTGGGGTGGGAGG - Intergenic
1007510801 6:42373138-42373160 GGCCATCCTGCTGGTGTGGCCGG + Intronic
1007924122 6:45637606-45637628 GGACATGACCCTGCTGTGACGGG - Intronic
1013831605 6:114279653-114279675 GGACATGGCCCCGGTATGGCTGG + Intronic
1016250413 6:142034569-142034591 GGACATGACCATAATGTGGCTGG + Intergenic
1017352534 6:153459177-153459199 GGCCATGGCCCTGGTGTACCAGG + Intergenic
1017829698 6:158115283-158115305 GGACATGAGCGTGGTGTGGCTGG + Intronic
1019341305 7:510331-510353 CAAGGTGCCCCTGGTGTGGCTGG - Intronic
1023890883 7:44391246-44391268 GGACATGCCCCTGGTGTGGCAGG + Intronic
1024508633 7:50184948-50184970 GGCCTTGCCCCTGGTGCAGCCGG + Intergenic
1027438848 7:78196655-78196677 GGGCAGGCCCCTGGTGTCTCTGG - Intronic
1029513047 7:101008779-101008801 GGACATCACCCTGGGGTGTCTGG - Intronic
1032117211 7:129127273-129127295 GGACCTGTCCCTGGTGGAGCTGG + Intergenic
1034448884 7:151126950-151126972 GCATTTGGCCCTGGTGTGGCCGG + Intronic
1036338258 8:7892717-7892739 GGACATGTGCATGGTGAGGCAGG + Intergenic
1038779580 8:30558440-30558462 GGCCAGGCCACTGGTGTGGATGG + Intronic
1039474797 8:37834011-37834033 GGACGAGCACCTGCTGTGGCTGG + Exonic
1039751130 8:40479780-40479802 GGACATGCACCTGCTGTCGTTGG - Intergenic
1039904858 8:41779119-41779141 GGACATGCCCAGGCTGTGACAGG + Intronic
1040280646 8:46040176-46040198 GGACATGCCCCGCATGGGGCAGG + Intergenic
1041093446 8:54326180-54326202 GAAGATGCTGCTGGTGTGGCTGG + Intergenic
1041464695 8:58146470-58146492 GGCCAAGCCCCCGGTGTGCCCGG + Exonic
1041646086 8:60253945-60253967 TCACATTCCCATGGTGTGGCAGG - Intronic
1043670702 8:82881072-82881094 GGGCATGGCACTGGTCTGGCAGG + Intergenic
1043890452 8:85647355-85647377 AGACCTGCCTCTGGTGTGCCAGG + Intergenic
1043892068 8:85659545-85659567 AGACCTGCCTCTGGTGTGCCAGG + Intergenic
1043894035 8:85723152-85723174 AGACCTGCCTCTGGTGTGCCAGG - Intergenic
1043894393 8:85726237-85726259 AGACCTGCCTCTGGTGTGCCAGG - Intergenic
1043894749 8:85729322-85729344 AGACCTGCCTCTGGTGTGCCAGG - Intergenic
1043895105 8:85732407-85732429 AGACCTGCCTCTGGTGTGCCAGG - Intergenic
1043897571 8:85749404-85749426 AGACCTGCCTCTGGTGTGCCAGG + Intergenic
1043897927 8:85752489-85752511 AGACCTGCCTCTGGTGTGCCAGG + Intergenic
1043898285 8:85755574-85755596 AGACCTGCCTCTGGTGTGCCAGG + Intergenic
1043899899 8:85767769-85767791 AGACCTGCCTCTGGTGTGCCAGG + Intergenic
1043901504 8:85779962-85779984 AGACCTGCCTCTGGTGTGCCAGG + Intergenic
1043901861 8:85783047-85783069 AGACCTGCCTCTGGTGTGCCAGG + Intergenic
1043903471 8:85795237-85795259 AGACCTGCCTCTGGTGTGCCAGG + Intergenic
1043905081 8:85807430-85807452 AGACCTGCCTCTGGTGTGCCAGG + Intergenic
1043906692 8:85819621-85819643 AGACCTGCCTCTGGTGTGCCAGG + Intergenic
1046941259 8:119933681-119933703 AGACATGAACCTGGGGTGGCAGG + Intronic
1049700193 8:144007385-144007407 GGACATGCCCCTGGTTTCTGAGG - Intronic
1060966422 9:127714628-127714650 GGACAAGCCCCTGGGGAGACTGG - Exonic
1061497989 9:130986566-130986588 GGTCTGGGCCCTGGTGTGGCAGG - Intergenic
1061875040 9:133539455-133539477 GGACATGACCCTAGGATGGCTGG - Intronic
1061949771 9:133929770-133929792 GGACAGGCCACTGGGGTCGCTGG - Intronic
1062139858 9:134949934-134949956 GGGCAAGCCCCTGGTGGGGTGGG + Intergenic
1062722072 9:138049822-138049844 GCACTTGGCCCTGCTGTGGCTGG + Intronic
1200223777 X:154405352-154405374 GAACATACCCCTGGTCAGGCAGG + Intronic