ID: 1023891334

View in Genome Browser
Species Human (GRCh38)
Location 7:44393996-44394018
Sequence AAACCTACCCACACCAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023891330_1023891334 -3 Left 1023891330 7:44393976-44393998 CCTCCAAGCTCCTGCTGCCAAAA 0: 1
1: 0
2: 0
3: 12
4: 237
Right 1023891334 7:44393996-44394018 AAACCTACCCACACCAAAGAAGG No data
1023891325_1023891334 12 Left 1023891325 7:44393961-44393983 CCTTCCACCTTCCCACCTCCAAG 0: 1
1: 1
2: 14
3: 92
4: 1023
Right 1023891334 7:44393996-44394018 AAACCTACCCACACCAAAGAAGG No data
1023891324_1023891334 24 Left 1023891324 7:44393949-44393971 CCTAACACTGCACCTTCCACCTT 0: 1
1: 0
2: 1
3: 39
4: 660
Right 1023891334 7:44393996-44394018 AAACCTACCCACACCAAAGAAGG No data
1023891326_1023891334 8 Left 1023891326 7:44393965-44393987 CCACCTTCCCACCTCCAAGCTCC 0: 1
1: 0
2: 15
3: 150
4: 1178
Right 1023891334 7:44393996-44394018 AAACCTACCCACACCAAAGAAGG No data
1023891331_1023891334 -6 Left 1023891331 7:44393979-44394001 CCAAGCTCCTGCTGCCAAAACCT 0: 1
1: 0
2: 3
3: 26
4: 264
Right 1023891334 7:44393996-44394018 AAACCTACCCACACCAAAGAAGG No data
1023891328_1023891334 1 Left 1023891328 7:44393972-44393994 CCCACCTCCAAGCTCCTGCTGCC 0: 1
1: 0
2: 2
3: 57
4: 515
Right 1023891334 7:44393996-44394018 AAACCTACCCACACCAAAGAAGG No data
1023891329_1023891334 0 Left 1023891329 7:44393973-44393995 CCACCTCCAAGCTCCTGCTGCCA 0: 1
1: 0
2: 1
3: 57
4: 538
Right 1023891334 7:44393996-44394018 AAACCTACCCACACCAAAGAAGG No data
1023891327_1023891334 5 Left 1023891327 7:44393968-44393990 CCTTCCCACCTCCAAGCTCCTGC 0: 1
1: 0
2: 14
3: 128
4: 1010
Right 1023891334 7:44393996-44394018 AAACCTACCCACACCAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023891334 Original CRISPR AAACCTACCCACACCAAAGA AGG Intronic
No off target data available for this crispr