ID: 1023895814

View in Genome Browser
Species Human (GRCh38)
Location 7:44431977-44431999
Sequence CTGTGGTTTTTAAAAACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 690
Summary {0: 1, 1: 0, 2: 5, 3: 58, 4: 626}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023895814_1023895821 24 Left 1023895814 7:44431977-44431999 CCATTTGTTTTTAAAAACCACAG 0: 1
1: 0
2: 5
3: 58
4: 626
Right 1023895821 7:44432024-44432046 ATCAATCTCAGCGATTTGGGAGG 0: 1
1: 0
2: 5
3: 222
4: 3686
1023895814_1023895819 20 Left 1023895814 7:44431977-44431999 CCATTTGTTTTTAAAAACCACAG 0: 1
1: 0
2: 5
3: 58
4: 626
Right 1023895819 7:44432020-44432042 TGCAATCAATCTCAGCGATTTGG No data
1023895814_1023895820 21 Left 1023895814 7:44431977-44431999 CCATTTGTTTTTAAAAACCACAG 0: 1
1: 0
2: 5
3: 58
4: 626
Right 1023895820 7:44432021-44432043 GCAATCAATCTCAGCGATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023895814 Original CRISPR CTGTGGTTTTTAAAAACAAA TGG (reversed) Intronic
900520514 1:3103218-3103240 GTTTGTTTTTTCAAAACAAAGGG + Intronic
900732227 1:4269674-4269696 CTCTGGTTTTTCAAAAAAAGTGG + Intergenic
904117453 1:28173279-28173301 CTGTGTCTCTTAAAAAAAAAGGG + Intronic
904144438 1:28378578-28378600 CTTGGGTTGTTAAAAAAAAAGGG - Intronic
907113226 1:51946350-51946372 GTGTGATTTTTAAAAATAAAAGG - Intronic
907511173 1:54961513-54961535 CTGTGATTTAGAAAAACAACTGG + Intergenic
907821803 1:57977301-57977323 CTCTGTTTTTTAAAAAATAAGGG - Intronic
907915813 1:58868826-58868848 CTGTGGTTTAAAAAAAAAAAAGG - Intergenic
908697523 1:66860621-66860643 GTGTGCTTTTAAAAACCAAAAGG - Intronic
908862808 1:68508507-68508529 CTGAAGATTTTAAAAAGAAAAGG - Intergenic
909274228 1:73664845-73664867 CAGTACTATTTAAAAACAAAGGG - Intergenic
909367245 1:74841127-74841149 CTCTGATATTTAAAAACTAATGG + Intergenic
909510602 1:76448023-76448045 CTGTGGTTTTTCAAGGCACATGG - Intronic
909926152 1:81439995-81440017 CTGTGGTCTTTAAAGGCACAGGG + Intronic
909928672 1:81469619-81469641 CTGTGGTTTTTTTAGATAAAAGG - Intronic
910076364 1:83284244-83284266 CTGTGCTTTTTACAAATCAAAGG + Intergenic
910309184 1:85804213-85804235 GAGTGGTCTATAAAAACAAAGGG + Intronic
910322502 1:85963908-85963930 TTGTAGTATTTACAAACAAAAGG - Intronic
910718625 1:90259814-90259836 CTGTGTTTTTTACAAACTGAAGG + Intergenic
910813412 1:91262143-91262165 CTGTGATCTTTAAAATGAAAAGG + Intronic
911184448 1:94889064-94889086 GTTTGGTTCTTAAAGACAAAAGG - Intronic
911568957 1:99498941-99498963 CTGTGGTCTTTAAAAAAAGGGGG + Intergenic
911711741 1:101081415-101081437 CTGTGCGTTTAAAAAAAAAAAGG + Intergenic
912178480 1:107189451-107189473 CAGTGGTCTTGAAAAAAAAAAGG + Intronic
912301453 1:108520894-108520916 CTGTGGGTTGTAAAAACCATGGG + Intergenic
912373152 1:109189099-109189121 CTGTGGGATTTGAATACAAATGG + Exonic
912626824 1:111212463-111212485 CAGTGGTTAATAAACACAAAAGG - Intronic
912871920 1:113314806-113314828 GAGTGGATTTTAAAAACAAGTGG + Intergenic
913271622 1:117099628-117099650 TTGTTGTTTTTAAAGACAAGGGG - Intronic
914322138 1:146575447-146575469 CTGTGGTTTTAAAAGGCACAAGG + Intergenic
916437976 1:164794174-164794196 TTTTGGCTTTTAAAAAGAAAGGG - Intronic
916482546 1:165227827-165227849 TTTTGTTTTTTTAAAACAAAAGG + Intronic
916691814 1:167197241-167197263 CTGAGGTTTTTGAAAACAAAGGG - Intergenic
917426752 1:174922465-174922487 CTGTGGTTTTAAAAATTGAAAGG - Intronic
917489718 1:175487798-175487820 CTCTTGTTTTTAATACCAAATGG + Intronic
917999131 1:180474769-180474791 CAGTGTATTTTTAAAACAAATGG + Intronic
918314422 1:183311135-183311157 ATTTGGTTTGTCAAAACAAAGGG - Intronic
918319060 1:183347618-183347640 CTGAGGGCTTTAAAAACACAAGG - Intronic
918780524 1:188694037-188694059 CTGTGCTTTTTCAAAGCAACAGG - Intergenic
918822728 1:189277158-189277180 TTTTGTTTTTTAAACACAAAAGG - Intergenic
919215604 1:194549640-194549662 ATATGTTTTCTAAAAACAAACGG - Intergenic
920807621 1:209250046-209250068 GTTTGGTTTATAAAAAGAAAGGG + Intergenic
921221967 1:212979829-212979851 CTGTGGTTCGTAAAGAGAAAGGG + Intronic
921435478 1:215115126-215115148 ATGTAAGTTTTAAAAACAAAAGG - Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
922178755 1:223217198-223217220 CTGGGGATTTTTAAAAAAAAAGG + Intergenic
922189322 1:223303264-223303286 TCTTGGTTTTTAAAAAGAAAAGG + Intronic
922227405 1:223657366-223657388 ATGTTGTTTTTAAAAAAAGAAGG + Intronic
922903156 1:229154123-229154145 CTGTGTTTTTTACAAACTGAAGG - Intergenic
923014721 1:230117851-230117873 CTGTGTTTTTTACAAACTGAAGG - Intronic
923174470 1:231450560-231450582 CTGAGGGTTTTAATCACAAAGGG - Intergenic
923472053 1:234300380-234300402 CTGGGATTTTTTAAGACAAATGG + Intronic
923803743 1:237236061-237236083 CTGTTGTTTTGAAAAATACATGG - Intronic
923814909 1:237366572-237366594 CTGTGTTTTTTAAATACAGTTGG - Intronic
923925855 1:238626547-238626569 CTGTGGCTTGTAACAAGAAAAGG + Intergenic
924389699 1:243540085-243540107 GTTTGCTTTTTAAAAACAAAAGG - Intronic
924425482 1:243946223-243946245 CTGTGATTTTTACTACCAAATGG + Intergenic
1063680551 10:8183451-8183473 TTGTGGATTTAAAAAAAAAAAGG + Intergenic
1063939938 10:11117994-11118016 CTATGTTTTTAAAAAACAAAAGG + Intronic
1064488410 10:15822095-15822117 CTTTGATTTTGAAAAACAAATGG + Intronic
1064831361 10:19470594-19470616 CTATTGTTTTGAAAAATAAAAGG - Intronic
1065058632 10:21873746-21873768 ATTAGGTTTTTAAAAAGAAAAGG - Intronic
1065245839 10:23756284-23756306 ATAAGGTTTATAAAAACAAAAGG + Intronic
1065678444 10:28204106-28204128 CTCATGTGTTTAAAAACAAATGG + Intronic
1065687324 10:28299640-28299662 CTGTGTTTTTTACAAACTGAAGG - Intronic
1066124187 10:32323393-32323415 CTGTGGTAATTATAAATAAAAGG - Intronic
1066164717 10:32774289-32774311 CTGTGGTTAAAAAAAAAAAAAGG - Intronic
1066694120 10:38062701-38062723 CTGTCTCTTTAAAAAACAAAAGG + Intronic
1066982834 10:42435284-42435306 CTGAGGGTTTTAATCACAAAAGG + Intergenic
1067855839 10:49792193-49792215 GTGAGGTTTATAAAAACACAAGG - Intergenic
1068016458 10:51522899-51522921 CTGTATTTATTAAAAACCAAGGG + Intronic
1070107051 10:73444396-73444418 CTGGGGCTTTTAAAAGAAAAGGG + Intronic
1070588440 10:77783659-77783681 CATTGGTTTTTAAGAACAAGAGG + Intergenic
1070690622 10:78522240-78522262 CTGTAGACTTTATAAACAAAAGG - Intergenic
1070938594 10:80322169-80322191 CTTCAGTTTTTAAAAATAAAAGG - Intergenic
1072362738 10:94675557-94675579 AAGTAGTTTTTAAGAACAAATGG + Intergenic
1073528461 10:104208565-104208587 CTGAGATATTTAAAAATAAAGGG + Intronic
1074974512 10:118569292-118569314 AAGTGGTTTTTATAAACCAAAGG + Intergenic
1075537113 10:123280704-123280726 CTGTGTTTGCTCAAAACAAATGG - Intergenic
1075623387 10:123944383-123944405 CTGTGGGTCTTTAAAACAAAGGG + Intergenic
1076157401 10:128214243-128214265 TTGTGATTATTAAAAAAAAAAGG - Intergenic
1076430086 10:130395588-130395610 CTGTTGTTCTAAAGAACAAAAGG + Intergenic
1076750520 10:132539856-132539878 GTTTGGTTTTTATTAACAAAAGG + Intronic
1076924141 10:133473270-133473292 CTGTAATTTTTAAGAAAAAAAGG - Intergenic
1078391199 11:10937041-10937063 CTGTGCTTCTTAAAAACTCATGG - Intergenic
1078756447 11:14215355-14215377 TTGTGGTATTCAAATACAAATGG + Intronic
1078948615 11:16101830-16101852 CTGAGGGTTTTAATCACAAAGGG - Intronic
1079419609 11:20273731-20273753 CTTTTGGTTTTAAAAACAGAAGG - Intergenic
1080514485 11:33007336-33007358 TTGTGGTTTTTAAAACCGACTGG - Intergenic
1080636962 11:34132581-34132603 CTGAGACTCTTAAAAACAAAAGG + Intronic
1080863559 11:36172515-36172537 CTGAGGGTTTTAATAAAAAAGGG + Intronic
1080991480 11:37541877-37541899 CTGTGGTTTATATTGACAAAGGG + Intergenic
1082172629 11:49024569-49024591 CTGTTGTTTATAAACAAAAATGG + Intergenic
1082564955 11:54665746-54665768 CTGTGTATTTGAAAAACAGATGG + Intergenic
1084485925 11:69448251-69448273 CTATTATTTTTAAAAACAGAAGG + Intergenic
1084671727 11:70610893-70610915 CTCTGAATTTGAAAAACAAATGG + Intronic
1084719275 11:70893828-70893850 CTGGGGATTTTACAAACATACGG + Intronic
1085922805 11:80979157-80979179 CTGTGGTTCTTAAAATATAAAGG - Intergenic
1086237623 11:84650977-84650999 CTGTGCTTTTTAAAAAGTGATGG + Intronic
1086770481 11:90758362-90758384 CTGTGGTTTATGCACACAAAGGG + Intergenic
1087141731 11:94770603-94770625 CTGTGCATTTTAAAAAGAAGGGG - Intronic
1087260970 11:96011941-96011963 CTGTGCTTGTTAAAAAGAAAAGG + Intronic
1087395589 11:97592962-97592984 CTGAGGTTTTTAATCATAAAGGG - Intergenic
1087429501 11:98034462-98034484 CAGAGGGTTTTAATAACAAAGGG + Intergenic
1087573380 11:99959925-99959947 ATGTGGATTTAAAAAAAAAATGG - Intronic
1087621250 11:100545306-100545328 CTGTATTTTTTTAAAAAAAAAGG + Intergenic
1087684406 11:101246836-101246858 CTGTTTTTTTTAAAAAAAAAAGG + Intergenic
1087906302 11:103701858-103701880 CTATGATTTTTTAAAACTAAAGG - Intergenic
1088199118 11:107310985-107311007 CCCTGGCTATTAAAAACAAATGG + Intergenic
1088387149 11:109271820-109271842 CTGAGGGTTTTAATAATAAAGGG + Intergenic
1089530105 11:119122092-119122114 CTGTGGTATTCAAGAAAAAAAGG - Intronic
1089986623 11:122820040-122820062 CTATGGTTTTATGAAACAAAAGG + Intergenic
1090483512 11:127089439-127089461 CTGAGGGTTTTAATAATAAAGGG - Intergenic
1090494556 11:127197590-127197612 CTGAGGTTTTCCAAAAAAAAAGG - Intergenic
1090619007 11:128544801-128544823 CTGTGGGTTTTACTATCAAAAGG - Intronic
1091357920 11:134952213-134952235 CTGTTAGCTTTAAAAACAAATGG + Intergenic
1091638916 12:2219499-2219521 CTGTAGTTTTTTTAAATAAATGG - Intronic
1092291819 12:7163966-7163988 CTGGGGTCTTTAAAAGCATAGGG + Intergenic
1092554796 12:9545960-9545982 CTGTGATTTTTAAAAATCATAGG + Intergenic
1092703992 12:11264434-11264456 ATGTGTGTTTTAAAAAAAAATGG + Intergenic
1093427515 12:19045091-19045113 CTGTGTTCTTTACAAACAGAAGG + Intergenic
1094294330 12:28887331-28887353 CAGTGGATTTTAAGAACGAATGG - Intergenic
1094517305 12:31144670-31144692 CTGTGATTTTTAAAAATCATAGG - Intergenic
1095121145 12:38421087-38421109 CTGAGGTTTTTAATCACAAAGGG - Intergenic
1095279694 12:40335637-40335659 CTGTGGTCTTTGAAGACAAAAGG + Intronic
1095503657 12:42868583-42868605 GTGTGGTTTTTTAAATAAAAGGG + Intergenic
1095511912 12:42960332-42960354 CAGTGTTTTTTAAGAATAAAGGG - Intergenic
1095847940 12:46767064-46767086 CTGTGATTATTAAAAATCAAGGG + Intronic
1096420213 12:51450820-51450842 TTGTTGTTTTTTAAAACTAAAGG + Intronic
1096447779 12:51709812-51709834 ATGTGGTTTTTAACAGAAAAGGG + Intronic
1097273773 12:57796756-57796778 CTGTGCCTTTCAAAAACAACAGG + Intronic
1097324774 12:58264084-58264106 CTGTTGTTTCTGAAAAGAAATGG - Intergenic
1097345709 12:58489551-58489573 CTGAGGTTGTCAGAAACAAAGGG - Intergenic
1097474811 12:60040138-60040160 ATCTGCTTTTCAAAAACAAAAGG + Intergenic
1097547401 12:61021854-61021876 CTGTGGATTTTAATCATAAAGGG + Intergenic
1097915502 12:65016748-65016770 ATGTGGTTTATAGACACAAAAGG + Intergenic
1098702569 12:73647010-73647032 CTTTGGTTCTTAGCAACAAAGGG - Intergenic
1099471425 12:83053941-83053963 CTGTGGTTCTCTAAAACAAAGGG - Intronic
1099968773 12:89478945-89478967 GCATTGTTTTTAAAAACAAAGGG + Intronic
1100320290 12:93484945-93484967 GTGTGTTTTTTAAAAAGCAATGG - Intronic
1100751206 12:97699851-97699873 TTGTTTTTTTTAAAAAAAAAAGG - Intergenic
1100942649 12:99740884-99740906 CTGTGGGTTGTAAAAACAGTGGG - Intronic
1101218638 12:102612196-102612218 CAGTGGCTTTGAAATACAAAAGG + Intergenic
1101587038 12:106094112-106094134 CTGTTGATTTAAAAAAAAAAAGG + Intronic
1101654088 12:106704760-106704782 CAGTGGTTGTTAATAACAATTGG + Intronic
1103367343 12:120392958-120392980 CTGTGCTTTTTAAAGAAAAGGGG - Intergenic
1104113554 12:125726766-125726788 CTGTGTTTTTTAAAAATTGATGG + Intergenic
1104113641 12:125727653-125727675 CTGTGGTTTTTACAAATTGAAGG + Intergenic
1104212749 12:126705681-126705703 TTGTGGTCTATAAAAGCAAATGG - Intergenic
1104697841 12:130877985-130878007 ATGTGGTTTTTTAAAAAAACTGG - Intergenic
1106001781 13:25730368-25730390 CTTTTGTTTTGAAGAACAAAAGG + Intronic
1106651296 13:31693052-31693074 ATGTGGTTTATATACACAAAGGG - Intergenic
1106866413 13:33969200-33969222 CTGTGGCTTTTCAAAAAGAAAGG - Intergenic
1106981457 13:35287424-35287446 ATATGGTTTTGAAAGACAAAAGG - Intronic
1107218688 13:37953410-37953432 TTGAGGTTTTTTAAAATAAATGG - Intergenic
1108750404 13:53442366-53442388 CTGTGGTTGTTGTAAACACAAGG + Intergenic
1109160396 13:58965911-58965933 CTCTGATTTTTATGAACAAATGG + Intergenic
1109288937 13:60449160-60449182 CGGATGTTTTTAAAAAGAAAAGG + Intronic
1109307079 13:60652712-60652734 CTTTGCTTATTAAAAGCAAACGG - Intergenic
1109871714 13:68341899-68341921 CTGATGGTTTTAAAAAAAAATGG - Intergenic
1109945662 13:69428240-69428262 CTGAGGTTTTTAATCATAAAGGG - Intergenic
1110050490 13:70891148-70891170 CTGTTGTTTTTAGAATGAAAAGG - Intergenic
1111371463 13:87323391-87323413 TTGTATTTTTTAAAAACAGATGG - Intergenic
1111401688 13:87745525-87745547 TTGTTGTTTTTAAAAACAGTGGG - Intergenic
1111422550 13:88033752-88033774 CTTTGGTTATTAAAAAGATAAGG - Intergenic
1111860294 13:93696541-93696563 TTTTGTTTTTTAAAAAAAAAAGG - Intronic
1112433434 13:99373262-99373284 CTGATTTTTTTAAAACCAAAGGG + Intronic
1112536153 13:100257925-100257947 CTGTAATTTTTAAAAATATACGG - Intronic
1113055684 13:106264611-106264633 CTGTGGTTTATTAAACCAAATGG - Intergenic
1113383101 13:109821411-109821433 CTGATGTTATGAAAAACAAAGGG - Intergenic
1113604384 13:111595072-111595094 CTGTGGCTTTTTACAGCAAAAGG + Intronic
1115251886 14:31357646-31357668 CTTTGGTTTTGAAAAACCAAAGG - Intronic
1115483235 14:33883263-33883285 CTGAGGTGTTTAAAAATAAAGGG + Intergenic
1115816488 14:37169553-37169575 CTTTGGCCTTTACAAACAAAAGG + Intronic
1115839448 14:37451659-37451681 CTTTGATTTTTAAAATCAATTGG - Intronic
1115854271 14:37612443-37612465 ATGTGATTTTTAAAAAGAAAAGG - Intronic
1116589148 14:46748967-46748989 CTGTGATTTTTAAAGATTAATGG - Intergenic
1116648363 14:47559313-47559335 CTGTGGTTTATAAGAGCAAGTGG + Intronic
1116672910 14:47866468-47866490 TTGTGGTTTTTAAAATGAAATGG - Intergenic
1117219945 14:53593405-53593427 TTGTGGTTTTTAAGTACAGAGGG + Intergenic
1117576084 14:57099659-57099681 TTGTGGTTTTTAAAGCCAGATGG - Intergenic
1117772393 14:59147434-59147456 CTGTGATTTCTATAGACAAAGGG - Intergenic
1118398158 14:65355156-65355178 CTTTACTTTTTAAAATCAAATGG + Intergenic
1118443696 14:65833582-65833604 ATGTCCTTTTTAAAAACAAGTGG - Intergenic
1118712564 14:68534433-68534455 CTGTGGTTTTTAAAGGATAAAGG + Intronic
1118925920 14:70189425-70189447 CTGTGGTTTTTAAATATAGCAGG + Intergenic
1120577900 14:86207097-86207119 ATTTGATTTTTAAAAAGAAAGGG - Intergenic
1120880983 14:89415368-89415390 CAGTGTTTGTTTAAAACAAAAGG - Intronic
1121648321 14:95535942-95535964 CTGTGGTTGCTACAAGCAAAGGG + Intronic
1121667659 14:95685469-95685491 TTGTGGTTTTCAAAAGGAAAAGG + Intergenic
1121931400 14:97975771-97975793 GTGAGATTTTTAAAACCAAAGGG - Intronic
1123673732 15:22687780-22687802 CTGTGGCTGCTAAAAGCAAAAGG - Intergenic
1124325733 15:28760771-28760793 CTGTGGCTGCTAAAAGCAAAAGG - Intergenic
1124448387 15:29761108-29761130 CTGTATTTTTTAAAAAAATAGGG + Intronic
1124548031 15:30650729-30650751 CTGTGGTATATACATACAAAGGG - Intronic
1125071197 15:35555441-35555463 CTGCAATTTTTAAAAAGAAATGG + Intergenic
1125103706 15:35946176-35946198 GTTTTGTTTTGAAAAACAAATGG + Intergenic
1125532155 15:40420707-40420729 TTGATCTTTTTAAAAACAAAGGG - Intronic
1125789332 15:42351460-42351482 CTTCTGTTTATAAAAACAAATGG - Intronic
1126744900 15:51816397-51816419 CAGTGTTTCTTTAAAACAAATGG + Intergenic
1126949769 15:53868353-53868375 CTATGGTTCTTTATAACAAAAGG + Intergenic
1127292449 15:57582508-57582530 TTGGGGTTCCTAAAAACAAAAGG - Intergenic
1127601415 15:60541078-60541100 CTGTGATTTTTAATAAAAACCGG - Intronic
1127651810 15:61016342-61016364 CTGTGGTTCTTAAAATAGAATGG + Intronic
1127778091 15:62284477-62284499 ATGTTTTTTTTAAAAAAAAAGGG - Intergenic
1128199862 15:65795320-65795342 TTGTGTTTTTAAGAAACAAATGG - Intronic
1128493588 15:68175836-68175858 CAGTGATTTTTAAAAATATATGG - Intronic
1129021103 15:72519221-72519243 CTCTGAATTTTAAAATCAAATGG - Intronic
1129964603 15:79722885-79722907 CTATGGTTTTTAATAAACAAAGG + Intergenic
1130099920 15:80885487-80885509 CTGTTGTTTTATAAACCAAAAGG + Intronic
1130212786 15:81941101-81941123 ATGTTTTTTTTAAAAAAAAAAGG + Intergenic
1130949259 15:88572722-88572744 ATCTATTTTTTAAAAACAAAAGG + Intergenic
1131030416 15:89181583-89181605 CTGTGGTCTTTGAAAAAATATGG - Intronic
1131201956 15:90406053-90406075 GTGTGGTTTTTAAAAATGAGGGG + Intronic
1131343012 15:91620536-91620558 CTGTAGTTTGTCGAAACAAAGGG + Intergenic
1131373970 15:91908297-91908319 CTCTGCTTTTTAAAGAAAAATGG + Intronic
1132436011 15:101803237-101803259 CTGTAATTTTTATACACAAAAGG + Intergenic
1133176239 16:4016993-4017015 CTGTTTTTTTGAAAAAGAAAAGG + Intronic
1134019963 16:10914837-10914859 CTTTGCATTTTAATAACAAAAGG - Intronic
1134337888 16:13318292-13318314 TTTTGGTTTTTAAAACTAAAGGG - Intergenic
1134637181 16:15801344-15801366 CTGTCTTTTTAAAACACAAAAGG - Intronic
1134782503 16:16911179-16911201 TTGTGTTTTTGAGAAACAAAAGG + Intergenic
1135478671 16:22802080-22802102 CTGTTGTTTTGAAAAAGAAGTGG - Intergenic
1135848216 16:25938584-25938606 CTATGGTATTAAAAAAAAAAAGG + Intronic
1136262129 16:29085568-29085590 CTGTCTTCTTTAAAAAAAAAAGG + Intergenic
1137294089 16:47073588-47073610 CTTTGCTATTTAAAAATAAATGG + Intergenic
1137342575 16:47624205-47624227 CTGTGGTTTATAGAACCAACTGG + Intronic
1137368658 16:47883867-47883889 CTTTGGCTTCTAAGAACAAAAGG - Intergenic
1137487495 16:48903698-48903720 CTGCTGTTTTTAAATTCAAATGG - Intergenic
1137776638 16:51060485-51060507 CTGTGGTTGTACAAAACACATGG + Intergenic
1138477490 16:57280488-57280510 CTTTTGGTTTTAAAAAAAAAAGG - Intronic
1140011487 16:71135719-71135741 CTGTGGTTTTAAAAGGCACAAGG - Intronic
1140585239 16:76282872-76282894 CAGTTTTTTTTCAAAACAAATGG + Intronic
1141596796 16:85101972-85101994 CTGGGGTGTTTAAAAACAAATGG - Intronic
1142180135 16:88664273-88664295 CTGAGCTATTTAAAAACTAAAGG - Intergenic
1144044390 17:11441934-11441956 CTGTGCTTGTTAGGAACAAAGGG - Intronic
1144787842 17:17841692-17841714 CTGTGGTTTTTCCAAGAAAAAGG - Intergenic
1144908138 17:18655312-18655334 CTGTAATTTTTAAAAACCCATGG - Intronic
1145289657 17:21533221-21533243 CTGTGGTTTTTCACACAAAAGGG - Exonic
1146696296 17:34911224-34911246 CTGTTTTTTTAAAAAAGAAAGGG + Intergenic
1147477902 17:40730976-40730998 CTTTTGTTTTTAATGACAAATGG + Intergenic
1147517037 17:41128799-41128821 CTGAGGGTTTTAATAATAAAAGG - Intergenic
1148010284 17:44474149-44474171 CTGTGTTATTTAAAAATAACGGG + Intronic
1149241081 17:54650300-54650322 ATGTGGTTTGATAAAACAAAGGG - Intergenic
1149262540 17:54895698-54895720 ATGTGGTTTTCAAAAACAATGGG + Intergenic
1149303151 17:55324135-55324157 CTGTTGTATTTGAAGACAAAAGG - Exonic
1150327552 17:64268991-64269013 CTGAGGTTATTAAATATAAATGG + Intergenic
1151018725 17:70587586-70587608 CTGTTTTTTTTTAAAAGAAATGG + Intergenic
1152890296 17:82877318-82877340 CTGCTATTTTTAACAACAAATGG - Intronic
1153122568 18:1747454-1747476 CTGAAGTGTTTAAAAAGAAAAGG + Intergenic
1153158772 18:2179478-2179500 CTGGGGTTTTTATAGACACAGGG - Intergenic
1153256370 18:3175637-3175659 CTCTTGTTTTTAATAACTAAAGG - Intronic
1153283741 18:3438247-3438269 GTTTAGTTTTTAAAACCAAATGG + Intronic
1153444767 18:5158574-5158596 CTGTAGTGTTTGAAACCAAATGG - Intronic
1155426803 18:25715611-25715633 GTGTGGTATTTAAAACCATAGGG - Intergenic
1155986982 18:32240072-32240094 CTGCTGTTTTTAAGACCAAATGG - Intronic
1156152513 18:34259266-34259288 CAGTGGTTTTTAAACTCAAGAGG - Intergenic
1156363186 18:36402177-36402199 TTTCTGTTTTTAAAAACAAAAGG - Intronic
1156812266 18:41266935-41266957 CTGTGTTTTATTACAACAAAAGG + Intergenic
1156905321 18:42345638-42345660 CTTTGATTTTCAAAAACCAAAGG + Intergenic
1156939382 18:42746853-42746875 CTGAGGGTTTTAATCACAAAGGG - Intronic
1157642365 18:49230349-49230371 CAAAGGTTTTTAAAGACAAATGG - Intronic
1158008764 18:52704304-52704326 CTCTTTTTTTAAAAAACAAATGG - Intronic
1159054548 18:63450867-63450889 CTTGGGTTTTTTAAATCAAAAGG - Intergenic
1159195977 18:65114918-65114940 ATTTGGTTTTTAAAAGCTAAAGG - Intergenic
1159378629 18:67628085-67628107 CTGAGATTTTTCAAACCAAAGGG + Intergenic
1159383894 18:67697361-67697383 ATCTGTTTTTTAAAAACAATAGG + Intergenic
1159529970 18:69643334-69643356 CTGTGTTGTTTATACACAAACGG - Intronic
1159687693 18:71443862-71443884 TTGTGGTTTTTGAAGATAAAAGG - Intergenic
1159977250 18:74728915-74728937 CGGTTGTTTTTAAAAAAGAAGGG + Intronic
1159978598 18:74748571-74748593 CTTTGGCTTTTAAAGTCAAAAGG - Intronic
1160072079 18:75637634-75637656 ATGTAGATTTAAAAAACAAAAGG + Intergenic
1163296855 19:16418174-16418196 CTGTCGTTTTTGAAAAGCAAGGG - Intronic
1166242417 19:41503428-41503450 CTGTGGTTTGTAATATCCAAAGG - Intergenic
1167085942 19:47309822-47309844 CTGTGGTTTTTAAAGCCCCAAGG - Intronic
1167118796 19:47504080-47504102 CTTTTTTTTTTAAACACAAATGG - Intronic
1168560533 19:57378678-57378700 ATATGGTTTTTAAAAAACAATGG + Exonic
1168588386 19:57613273-57613295 TTATGGTTTTAAAAAAGAAAAGG - Intergenic
925494813 2:4435215-4435237 CTGTGGTTTTTCCAGGCAAATGG + Intergenic
925702644 2:6654319-6654341 CTGTGGTTTTAAAGAACAGACGG + Intergenic
926065670 2:9837786-9837808 GTGTTGTTTATAAAAAGAAATGG - Intergenic
926342133 2:11912268-11912290 CTGTGATCTTTAAAAGCAATGGG - Intergenic
926530631 2:14040538-14040560 TTGTGGTATTTAGAAAAAAACGG + Intergenic
926959265 2:18336540-18336562 CTGTGAGCTTTAAAAAGAAAAGG - Intronic
927119680 2:19945616-19945638 CTGTGGATTTTAAAAATATTTGG - Intronic
927226728 2:20773668-20773690 CTGTGGTTTTTGATACTAAATGG - Intronic
928738357 2:34319531-34319553 CATTGATTTTTAAAAACTAAAGG + Intergenic
928894971 2:36250630-36250652 CTGGAGTTTTTAAGAACTAAAGG - Intergenic
928926774 2:36587867-36587889 CTGAGTTTCTGAAAAACAAATGG - Intronic
929165628 2:38878199-38878221 CAGTGGATTCTAAAAAAAAATGG - Intronic
929179522 2:39020599-39020621 CAGTAGTTCTTAAAAACAAATGG + Intronic
929247807 2:39721638-39721660 CTCTGGTAATTGAAAACAAACGG + Intergenic
929618680 2:43333193-43333215 TTGTGTTTTTTAAATACAAAAGG - Intronic
930048047 2:47191428-47191450 CTGTGATTTTTAAATGGAAAGGG - Intergenic
930159710 2:48142326-48142348 CTGAGGGTTTTAATCACAAAGGG + Intergenic
930257150 2:49105471-49105493 CTTTGTTTTTTAAGCACAAAAGG - Intronic
930281158 2:49371756-49371778 GTCTGATTTTTAAAATCAAATGG + Intergenic
930564861 2:53006021-53006043 TTGTGGTTTTTAAATATAAATGG - Intergenic
930934438 2:56930335-56930357 TTGTGTTTTTTACAAACTAAAGG - Intergenic
931429909 2:62200371-62200393 CTGTGGCATTTTAAAACAGAGGG + Intronic
931679228 2:64729464-64729486 ATGTAGTTTTAAAAAATAAACGG - Intronic
931845786 2:66202617-66202639 CTGTGGATTCTAAAAGCAAATGG + Intergenic
931989307 2:67773772-67773794 AGGTCATTTTTAAAAACAAAAGG - Intergenic
932092175 2:68816131-68816153 CTGTGGGTTTAAAAAAAAAAAGG - Intronic
932270639 2:70406127-70406149 CTGAGAGTTTTAATAACAAAGGG - Intergenic
932375739 2:71234294-71234316 CTGTTGTTTTGAAAATTAAATGG - Intergenic
932518550 2:72381109-72381131 TAGTACTTTTTAAAAACAAATGG - Intronic
932857657 2:75254104-75254126 CTGTGCGTTTCCAAAACAAAAGG + Intergenic
933231041 2:79807741-79807763 TTGTGCTTTTTAAAGCCAAATGG - Intronic
934901681 2:98164839-98164861 CTTTGGTTTATAAGAAAAAAAGG - Intronic
935348756 2:102135142-102135164 CTGTTTTTTTTAAAATCAAAAGG + Intronic
935399376 2:102644301-102644323 CTGTGGGTTGCAAAAACCAAGGG - Intronic
936761641 2:115792416-115792438 ATGTGGTTTGTTAAAATAAAGGG - Intronic
936910843 2:117591619-117591641 CTGAGGGTTTTAACCACAAAGGG + Intergenic
937393433 2:121513637-121513659 CTGTGATTTTTTATAGCAAAAGG + Intronic
938020056 2:127898947-127898969 CTGTGGATTAAAATAACAAAAGG - Intergenic
938853704 2:135288123-135288145 CTGAGGGTTTTAATCACAAAAGG + Intronic
938872570 2:135495796-135495818 CTGAGGTTTTTGAAAACACAGGG + Intronic
938968336 2:136407998-136408020 ATCTGGTTTTAAAAGACAAAAGG + Intergenic
939075057 2:137589968-137589990 CTATGATTTTTAAACACAACTGG - Intronic
939144339 2:138394597-138394619 CTGCTGTTATTAAAAACAAGAGG + Intergenic
939646654 2:144707829-144707851 TTGAGTTTTTTAAACACAAAAGG + Intergenic
939706074 2:145455430-145455452 AAGTGGTTATTAAAAAAAAATGG - Intergenic
940190373 2:151034604-151034626 CTTTGGTGTTTTAAAAAAAAGGG + Intronic
940200591 2:151145909-151145931 CTGTAGTAGTTAAAAAAAAAAGG - Intergenic
940430840 2:153588172-153588194 CTGTGGTTTTTCCAGGCAAAGGG + Intergenic
941037359 2:160582875-160582897 CTGTGTTCTTAAAAAAAAAAAGG + Intergenic
941484012 2:166056153-166056175 CTGTAGATTTTAAAGAAAAAGGG + Intronic
942673232 2:178399662-178399684 ATGTTGTTTTGGAAAACAAAAGG - Intergenic
943044684 2:182846116-182846138 ATTTATTTTTTAAAAACAAAAGG + Intronic
943081052 2:183259671-183259693 CTGTTGTATTTTAAAATAAAAGG + Intergenic
943167761 2:184352136-184352158 CTGAGGGTTTTAATCACAAAGGG - Intergenic
943231291 2:185255836-185255858 CTTTGGTTTTTTAAAAAGAAAGG + Intergenic
943587153 2:189754732-189754754 CTGTAGTATTCTAAAACAAAGGG + Intronic
943672983 2:190683937-190683959 ATGACGTTTTAAAAAACAAACGG - Intronic
943753114 2:191530735-191530757 CTGTGGTTTGAAACAAAAAAGGG - Intergenic
943846804 2:192660195-192660217 GTGTGGTTTTTAAAATCCAGAGG + Intergenic
943943819 2:194032844-194032866 CTGAGGGTTTTAATAATAAATGG - Intergenic
944417262 2:199491288-199491310 CTGAGTTTTTTAAAAATAATTGG + Intergenic
945137731 2:206646668-206646690 CTGTGGTTATACAAACCAAATGG - Intergenic
945515369 2:210757785-210757807 CTGTGGTTTTGATAATCATATGG + Intergenic
945587502 2:211684859-211684881 CTGGGGTTTTTAAGAGCAAGGGG - Intronic
946364505 2:219240440-219240462 TAGTGTTTCTTAAAAACAAATGG + Intronic
946615392 2:221503679-221503701 CTGTGTTTTATAAAAGCAAAAGG - Intronic
947044169 2:225959609-225959631 TTATGGTTGTTAAAAACATAAGG + Intergenic
947087564 2:226472651-226472673 CTGTGGCTTATAAAATCAAAAGG - Intergenic
947680542 2:232027947-232027969 CTGTGCTTTTTAAAAATGACAGG - Intronic
1169050702 20:2575259-2575281 TTGTGATTTTAAAAAACACATGG - Intronic
1169502149 20:6170869-6170891 CTCAGGCTTTTAAAAACAGAGGG + Intergenic
1169933248 20:10856424-10856446 CTGTGGATGATAAAAAGAAAGGG + Intergenic
1169976729 20:11337747-11337769 CAGTGATTTTTACAAACAAGTGG + Intergenic
1170155465 20:13265137-13265159 CTGTGGTTTATAGATCCAAAGGG - Intronic
1170488714 20:16847735-16847757 ATGCTGTTTTTAAAAAAAAATGG - Intergenic
1170978707 20:21190814-21190836 CTTTGATCTTTAAAAACATATGG - Intronic
1171035759 20:21711534-21711556 CTGTAGCTTTTAAAAACAGGTGG - Intronic
1171721328 20:28566121-28566143 CTGAGGGTTTTAATCACAAAGGG - Intergenic
1172012434 20:31853386-31853408 CTGTGGTTTTTAAAATCATCTGG - Intronic
1172538574 20:35693419-35693441 GTGTGTTTTTTTAAAACCAATGG - Intronic
1173079306 20:39850677-39850699 ATGAAGTTTTTAAAAGCAAAAGG + Intergenic
1174334379 20:49848287-49848309 ATTTGGTTTTTCAAAACAAAGGG - Intronic
1174886492 20:54340714-54340736 CTGAGGTTTGGAAAAACACAAGG + Intergenic
1175568060 20:59996306-59996328 CCATGGTTATTACAAACAAAGGG - Intronic
1175813061 20:61869203-61869225 CATTGGTTTTTAAAAATACAGGG - Intronic
1177516383 21:22156750-22156772 GCGTAGGTTTTAAAAACAAATGG - Intergenic
1177953606 21:27569353-27569375 CTGTCCTTTTTAAAAAAATAAGG - Intergenic
1178377378 21:32078094-32078116 TTGTGCTTTTAACAAACAAAAGG + Intergenic
1179201376 21:39224992-39225014 TTCTGGTTTTTAAAAAAACATGG - Intronic
1179230311 21:39498146-39498168 TTGTGGTTTTGAAACAGAAATGG - Intronic
1179256961 21:39725538-39725560 CTGAGGTGTTTAAAAACATGGGG - Intergenic
1179314447 21:40229410-40229432 CTGTGGTTTTGACAAATACATGG + Intronic
1180294870 22:10924778-10924800 CTGAGGGTTTTAATCACAAAGGG - Intergenic
1180653391 22:17397812-17397834 CTGTGGTGTTTTAAAATAAATGG + Intronic
1182123961 22:27803208-27803230 CTAAGGTTTTTAAATAAAAAGGG - Intergenic
1182312429 22:29418805-29418827 TTCTGGTTTTTAAAAAGAATGGG - Intronic
1182468927 22:30535193-30535215 CAGTGGATGTTATAAACAAATGG + Intronic
1182803260 22:33049528-33049550 CTGTGCTTTTTAATAACCACGGG + Intronic
1184124397 22:42476803-42476825 CTGGAGTTTTTAAAGAAAAAAGG - Intergenic
1184506576 22:44907371-44907393 CTGTGGTTTGTAAATCCTAAAGG + Intronic
1184674259 22:46031981-46032003 CTTTGGTTCTTAAAACAAAACGG + Intergenic
949356039 3:3181585-3181607 CACTGGTTATTAAAACCAAAAGG + Intergenic
949602575 3:5616197-5616219 CTGAGTTTTGTAAAAACACAAGG + Intergenic
949863965 3:8532094-8532116 CTGAGGTGTTTAAACCCAAATGG - Intronic
950169896 3:10831186-10831208 CTGTTGTTTAGAAAAAAAAATGG - Intronic
951604873 3:24422091-24422113 ATGTAGTTTTCAAAAACAAAGGG + Intronic
952024618 3:29064064-29064086 CTGTGGGTTATAGAAACAGACGG + Intergenic
952192143 3:31035184-31035206 CTGTTATTTTTAAAACCCAAGGG + Intergenic
952196612 3:31082317-31082339 GTGTAGTTTATAAAAACCAAAGG + Intergenic
953007127 3:38988932-38988954 ATGTGGTTTTTTAAAAACAATGG + Intergenic
953948747 3:47171326-47171348 CTGTCTCTTTTAAAAAAAAAAGG + Intergenic
954963132 3:54583794-54583816 CTTTGGGTCTTAAAGACAAAAGG + Intronic
955237735 3:57154818-57154840 CTGTGGCTTACAAAAAAAAATGG - Intronic
955266120 3:57446923-57446945 AGATTGTTTTTAAAAACAAATGG - Intronic
955287891 3:57661642-57661664 GTGTGGATTTTAAAATAAAAAGG + Intronic
955306139 3:57834638-57834660 ATCTGTTTTTTAAAAACAGAGGG - Intronic
955508477 3:59655534-59655556 CTGTGGTTCCTAACAACAATGGG + Intergenic
955969359 3:64421759-64421781 CTTTGTTTTTTTAACACAAATGG - Intronic
956262802 3:67363705-67363727 CTGTGGTTTTTGAAAAAATATGG + Intronic
956539970 3:70325732-70325754 CAGATGTTTATAAAAACAAAGGG + Intergenic
956798871 3:72739170-72739192 GCATGGTGTTTAAAAACAAAGGG - Intergenic
956913679 3:73848246-73848268 CTGTTATTTTTAAAAAGAGAAGG - Intergenic
957127212 3:76177339-76177361 CTGTCATTTTCAAAAACAATTGG + Intronic
958775324 3:98475905-98475927 CTGAGGGTTTTAATAATAAAAGG + Intergenic
959389240 3:105753366-105753388 CTGTTTTTTTTAAAAAAAAAAGG + Intronic
959625440 3:108444522-108444544 ATGTGGTTTTCAAATACCAAAGG - Intronic
959786688 3:110307193-110307215 CTATGTTTTTTAAAAACCACAGG + Intergenic
960050821 3:113237701-113237723 CTGTATTTTTCAAAACCAAAAGG - Intronic
960404920 3:117248034-117248056 CTGTGATCTTTTAAGACAAAGGG + Intergenic
962064327 3:131963225-131963247 CTGTGGGTTGTAAAAACCATGGG - Intronic
962094503 3:132279513-132279535 CTGTGTATTTTATAAAGAAAAGG + Intronic
962404435 3:135088456-135088478 TTGTGGGTTTTAAAAATACAGGG + Intronic
962650944 3:137490202-137490224 CAGTGGCTTAAAAAAACAAAGGG - Intergenic
963391390 3:144668210-144668232 CTGAGCTCTTGAAAAACAAATGG - Intergenic
964098179 3:152958004-152958026 CTGTGGTATTTTAAAACAGTGGG - Intergenic
964230619 3:154462929-154462951 GTGTGGTGGTTAAAAACAGAGGG + Intergenic
964301064 3:155285405-155285427 CTTTGGTTTTTAAACAGACAGGG - Intergenic
964566730 3:158064114-158064136 ATTTGGTTTTTAAAATAAAATGG - Intergenic
965060728 3:163782452-163782474 CTGAGGGTTTTAATAATAAAGGG + Intergenic
965465569 3:169026308-169026330 TTGTGATTTTTGTAAACAAATGG - Intergenic
965505123 3:169506927-169506949 ATGTGAATTTTAAAAACAAATGG - Intronic
965610926 3:170543341-170543363 CTGTGCTTCTTAAAGACAGAGGG - Intronic
965807572 3:172557994-172558016 CTAGGGTTTTATAAAACAAAGGG + Intergenic
967745432 3:193049700-193049722 CTGGGGTTTCTTGAAACAAATGG + Intergenic
967784680 3:193479068-193479090 CTGAGGGTTTTAATAATAAAGGG - Intronic
967968080 3:194978071-194978093 AATTGGTTTTTAAAAACTAATGG + Intergenic
968204959 3:196791302-196791324 GTGTGTTATGTAAAAACAAATGG + Intronic
968883343 4:3313115-3313137 CTCTGCTTATTAAAAAGAAATGG - Intronic
969060188 4:4427969-4427991 CTCTGTGTTTAAAAAACAAAAGG + Intronic
969408590 4:7012676-7012698 CTGTTGTATTTAACAATAAAAGG + Intronic
969940859 4:10729944-10729966 ATTTGTTTTTCAAAAACAAATGG - Intergenic
969940860 4:10729946-10729968 ATTTGTTTTTGAAAAACAAATGG + Intergenic
970076858 4:12232011-12232033 CTGTGGTTCAGAAAAAAAAAAGG + Intergenic
970248933 4:14093802-14093824 CTGTGATTGTTATAAGCAAAAGG + Intergenic
970762035 4:19501858-19501880 TTGTGGTGTTTCAAAACAACAGG - Intergenic
971121770 4:23712420-23712442 CTGATGTTTTTAAAATCATATGG - Intergenic
971592177 4:28482220-28482242 CTGTTGTGTTAAAAAGCAAAGGG + Intergenic
971994790 4:33951717-33951739 CTGTGGTGGTCAAGAACAAATGG - Intergenic
972104148 4:35461671-35461693 CTCTGGTTTTTTAAAGCAGAAGG + Intergenic
972134459 4:35874780-35874802 CTATGCTTTTAAAATACAAAAGG - Intergenic
972393171 4:38632305-38632327 CTTTGTTTTTTAAGAAAAAAAGG + Intergenic
972721535 4:41703932-41703954 ATGTGTTTTTAAAAAAAAAAAGG + Intergenic
973189079 4:47366478-47366500 CTGAGGCTTTTAAAAACCAGTGG - Intronic
974974215 4:68870020-68870042 GTGAGGTTTATAAAAACAGAAGG + Intergenic
974981213 4:68959814-68959836 GTGAGGTTTATAAAAACAGAAGG + Intergenic
975063120 4:70028371-70028393 ATGTTATTTTGAAAAACAAAAGG + Intergenic
975070513 4:70132070-70132092 CTTTTGTTTTTAAAAATAAGAGG + Intergenic
975204425 4:71628145-71628167 CTGAGGGTTTTAAACATAAAGGG - Intergenic
975913177 4:79293261-79293283 CCTTAGTGTTTAAAAACAAAGGG + Intronic
976280101 4:83318841-83318863 CTGTGGCTTTTGCAAACACAGGG - Intronic
976293759 4:83448962-83448984 CTGTGGAATTAAAAAAAAAAAGG + Intronic
976452691 4:85209526-85209548 CTGTGAGTTTTTAGAACAAAAGG - Intergenic
976663503 4:87565226-87565248 CTGTAGTTCTAAAAAGCAAAGGG + Intergenic
976758686 4:88525016-88525038 CTGTTTTTTTTAAAAAAAACAGG - Intronic
977296594 4:95216543-95216565 GTGGGGATTTTAAAAAAAAATGG - Intronic
977558371 4:98507585-98507607 CTGTGGTTGTCAAAGAGAAAGGG + Intronic
977631534 4:99248361-99248383 CTGTGGTTTGCAAAAACCATGGG + Intergenic
977799422 4:101208350-101208372 CTGTGGTTGTTGAGAACAATGGG - Intronic
978070127 4:104456616-104456638 CACTGATTTTTAAAAAGAAATGG - Intergenic
978594313 4:110360361-110360383 ATGACGTTTTTAAAAAGAAATGG + Intergenic
979296969 4:119044208-119044230 ATGTGCTTTTCAAATACAAATGG - Intronic
979353620 4:119675468-119675490 ATGTGCATTTTAAAAGCAAAGGG - Intergenic
980886667 4:138769865-138769887 ATGTGGTGTTTAATAAAAAAGGG - Intergenic
981659274 4:147146831-147146853 TTGTGGTTATTAAAAACTATAGG - Intergenic
981935769 4:150238348-150238370 CTATGACTTTTAAAAACTAAGGG - Intronic
981974650 4:150711157-150711179 CTGTGATTTTTAACCACAAAAGG - Intronic
982656216 4:158152801-158152823 CTGTGGGTTTTAATCATAAATGG - Intronic
982816187 4:159887791-159887813 CTATGGATTTGAAAAATAAAAGG + Intergenic
983002294 4:162431647-162431669 ATGTAGTTTTTAGAAAAAAATGG - Intergenic
983185636 4:164697355-164697377 CTGCAGTTTTTTAAAACCAATGG + Intergenic
983868135 4:172792271-172792293 CTGTAGTTTTTAAACATTAAGGG - Intronic
983962759 4:173774461-173774483 CTGAGGGTTTTAATCACAAAGGG + Intergenic
985534984 5:459589-459611 CTGTGTTCTTCAAAAGCAAAGGG + Intronic
986188352 5:5467259-5467281 CTGTGGTGATTAAAATCAGATGG + Intronic
986300754 5:6476780-6476802 TTGAGATTTGTAAAAACAAACGG + Intronic
986476684 5:8141898-8141920 CTGTGTTTTTCAAAAAAAAGAGG + Intergenic
986579537 5:9250581-9250603 TTCTGGATTTTTAAAACAAATGG + Intronic
986691395 5:10316580-10316602 CTGTGGTTTTTGAATAGGAATGG - Intergenic
987767875 5:22258295-22258317 CTATAGTTTTGAAAGACAAAAGG + Intronic
988180919 5:27791944-27791966 CTGTGTTTTTCAAAAACTAAAGG - Intergenic
988423977 5:31040943-31040965 CTGAGGGTTTTAATCACAAAAGG - Intergenic
988599983 5:32630906-32630928 CTGGGGATTTTAGAAACCAATGG + Intergenic
988939096 5:36123582-36123604 CTGTGGGTTTAAAAGACAATTGG + Intronic
989116828 5:37963046-37963068 ATGTGCTTTTGAAAAAAAAATGG - Intergenic
989474698 5:41861287-41861309 GTGTGCATTTTAAAAACAATTGG - Intronic
989775196 5:45198336-45198358 CTGCGGTTTTTAATCAAAAAAGG - Intergenic
990250611 5:53910789-53910811 CTGGGTTTTTGAAAAACGAAAGG - Intronic
990759894 5:59117316-59117338 TAATGGTTTTTAAAAACAGATGG - Intronic
990796545 5:59548662-59548684 TAGTTGTTTTTAAAAACAGATGG + Intronic
990977755 5:61574130-61574152 CTGTGGCATTTAAAATGAAATGG - Intergenic
991228602 5:64302931-64302953 CTGTGTTTTTAACAAACAGAAGG + Intronic
991358490 5:65794915-65794937 CTTTTGTTTTAAAAAACAGAGGG + Intronic
991603310 5:68374987-68375009 CTTAGGTTTAAAAAAACAAAAGG + Intergenic
991714399 5:69437893-69437915 CTGTGATTTTTAACAAGACAGGG + Intronic
992352754 5:75947890-75947912 CTCTTGATTTTAAAAAAAAATGG - Intergenic
993072147 5:83178567-83178589 CTGTTGGTTTTGAAAACAAAGGG + Intronic
993149974 5:84148943-84148965 TTGTTGTTTTTTAAAACAAGAGG - Intronic
994052492 5:95378775-95378797 CTTTGATTTTTAAAAAGATAAGG + Intergenic
994332888 5:98527861-98527883 CTCTGTTTTTTATAAACAGATGG - Intergenic
994339073 5:98604377-98604399 TTGGGATTTTTCAAAACAAACGG + Intergenic
994680748 5:102883903-102883925 CTGAGGGTTTTAAATATAAAGGG + Intronic
994822490 5:104671679-104671701 ATGTGATTTTCAAAAACTAATGG + Intergenic
994830556 5:104776784-104776806 TTGTCCTTTTTAAAAACAAAAGG + Intergenic
995382601 5:111551350-111551372 CTGTGTCTTGAAAAAACAAATGG + Intergenic
996025532 5:118641379-118641401 CTGAGGTTTTTAATAATAAAGGG - Intergenic
996116183 5:119622169-119622191 GTGTGGATTTTAAAAAAAACAGG - Intronic
997067056 5:130573497-130573519 ATGTGTTTATTATAAACAAATGG + Intergenic
997403855 5:133627231-133627253 CTGTGGAATTTATAAAGAAAAGG + Intergenic
997558794 5:134825545-134825567 TTGTGTTTTTTAAAAATACACGG + Intronic
997574493 5:134963795-134963817 CTGTGGTTTATACAAGAAAATGG - Intronic
997911959 5:137883721-137883743 CTGTGGTTTGTAGATAAAAATGG - Intronic
998553574 5:143101454-143101476 CTTTGGTTTTTATTAACAAAAGG + Intronic
998806720 5:145924322-145924344 CTTTGGTTTTCAGTAACAAATGG - Intergenic
998971164 5:147594060-147594082 ATGTTGGTTTTAAAAACCAATGG + Intronic
1000197572 5:158974244-158974266 CTGAAGTTTTTAAAAAGAGAAGG - Intronic
1000310276 5:160036818-160036840 ATGTGCTTTTTAAAAAGAAAAGG - Intronic
1000992582 5:167926365-167926387 CTCTGCTTTTTAAAAACTAAGGG - Intronic
1001000913 5:168006197-168006219 CTTTGGCTTTTAAAGATAAATGG - Intronic
1001050171 5:168407867-168407889 CCCTGGTTCTTAAAAAAAAAAGG - Intronic
1003709944 6:8578194-8578216 ATATGGTTTTTAAAAATTAAGGG + Intergenic
1003794151 6:9581296-9581318 CTCTGGTTGTTATAAACCAAGGG + Intergenic
1004921429 6:20379630-20379652 CTATGGTTTTTCAAAATCAAAGG - Intergenic
1004963208 6:20816132-20816154 CTGTTGTCCTTAAAAAAAAAAGG - Intronic
1005156327 6:22810976-22810998 CTGTATTTTTTTAAAATAAAAGG + Intergenic
1005339248 6:24828026-24828048 CTGTGGACTTGAAAAATAAAAGG + Intronic
1005769236 6:29049692-29049714 AAGTGGTTTTTAAAAGAAAAAGG - Intergenic
1006924138 6:37645052-37645074 CTATAGTTTTGAAATACAAATGG + Intronic
1007682498 6:43644320-43644342 CTGTTGTTTTTAGATCCAAATGG - Intergenic
1008419985 6:51287245-51287267 ATGTTGTTTTTAAAAATGAAAGG - Intergenic
1008537212 6:52515564-52515586 CTGTGGTTTTGAAACAGCAAAGG - Intronic
1009858578 6:69295118-69295140 CTGTGGTTTTTAGTAACATCAGG - Intronic
1010134701 6:72537586-72537608 CATTGATTTTTAAAAACATAAGG + Intergenic
1010259021 6:73794323-73794345 CTCTGGTTTTTAGAAGCAATGGG + Intronic
1010478315 6:76317526-76317548 CAGTTGTTTTTGCAAACAAATGG + Intergenic
1011084344 6:83522672-83522694 CTTTGTTTTTTAAAAATACATGG + Intronic
1011147662 6:84236365-84236387 CTGTGGTTTTAAAACACTAATGG - Intergenic
1011265589 6:85514892-85514914 TTGTGGTATGTAAAAACAAAGGG - Intronic
1011383341 6:86766618-86766640 AAGTGGTTTCTAAAAACAGATGG + Intergenic
1011729935 6:90251210-90251232 CTGAGGTTTTTAGGAAAAAATGG - Intronic
1011936536 6:92785582-92785604 ATGTGTTGTTTAAAAATAAAAGG + Intergenic
1012084133 6:94801837-94801859 CTGTGTTTTTTACAAACTGAGGG + Intergenic
1012352916 6:98275697-98275719 TTGTAGTGTTTAAAGACAAAAGG + Intergenic
1013569454 6:111407103-111407125 CTGTGTCTTAAAAAAACAAAGGG + Intronic
1013853986 6:114549659-114549681 CTCCGTTTTTTAAAAACAATTGG + Intergenic
1013876364 6:114834741-114834763 CTGAGCTTTTCAAAAACAATTGG + Intergenic
1013915188 6:115328763-115328785 GTAAGTTTTTTAAAAACAAATGG - Intergenic
1014098565 6:117484748-117484770 GTGTGGTTTTAGGAAACAAATGG + Intronic
1014630889 6:123788678-123788700 CTGTGCTTTTTCAAAACAATGGG - Intergenic
1015338725 6:132072912-132072934 CTGTGATGTGTAAATACAAAAGG - Intergenic
1016365849 6:143317456-143317478 CTGAGGGTTTTAATAATAAAGGG - Intronic
1016375908 6:143420370-143420392 GTGTGATTTTTAAAAATTAATGG - Intergenic
1017449189 6:154537857-154537879 GTGTGATTTTTAGTAACAAAGGG + Intergenic
1017657095 6:156640329-156640351 CTGTTGTTTTAGAAAATAAATGG - Intergenic
1017712167 6:157180630-157180652 ATGTTATTTTTAAAAATAAAAGG - Intronic
1018523026 6:164673613-164673635 CTGTGTTTCTTAAAAATGAAAGG + Intergenic
1018523724 6:164683583-164683605 CTGTTATTTATAAAAACAGAGGG - Intergenic
1018987144 6:168646478-168646500 CTTTGTCTTTTAAATACAAATGG - Intronic
1019426426 7:979441-979463 CTGCGTTTTTTAAAAAGATAAGG - Intergenic
1019761437 7:2815625-2815647 TTGTGGTTTCTGAAAAGAAATGG - Intronic
1020596888 7:10217948-10217970 CTGTGATTTTTACAAACTGAAGG - Intergenic
1020617276 7:10475634-10475656 CTGTCGTTTTTCAGAAGAAATGG - Intergenic
1021591365 7:22266818-22266840 AAATGATTTTTAAAAACAAATGG + Intronic
1021664747 7:22965319-22965341 TTGTGGTTTTTAAACATTAACGG - Intronic
1021778078 7:24073428-24073450 CTTTAGTTTTTAAAATAAAATGG - Intergenic
1021967853 7:25939354-25939376 CTATTGTTTTTAAAAAGAGAAGG + Intergenic
1022093680 7:27124589-27124611 GTGTGTTTTTAAAAATCAAATGG + Intronic
1022125096 7:27348838-27348860 ATGTGGCTTTTAAAAATACAGGG + Intergenic
1022182419 7:27934337-27934359 CTCTGATTTTTAAAGCCAAAAGG + Intronic
1022868398 7:34447256-34447278 CTATGCTATTTAAAAAGAAAAGG + Intergenic
1023119826 7:36898272-36898294 CTGTGGGTTTTTCAAACAAATGG - Intronic
1023251227 7:38263634-38263656 CTGTGATGTTAAAAAAAAAAAGG + Intergenic
1023508097 7:40921336-40921358 CTTTGGATTTTGAAAACACAAGG - Intergenic
1023623209 7:42093117-42093139 ATCTTGTTTTTAAAAACAGAAGG + Intronic
1023895814 7:44431977-44431999 CTGTGGTTTTTAAAAACAAATGG - Intronic
1024473743 7:49789646-49789668 CTGTAATTCTTTAAAACAAAAGG + Intronic
1024571831 7:50729670-50729692 CTGCCATTTTTAAAATCAAAAGG - Intronic
1024943840 7:54789195-54789217 CTGTGGGTTTTGAACCCAAAAGG - Intergenic
1024946515 7:54813237-54813259 CTGTAGTTGATGAAAACAAATGG - Intergenic
1026135871 7:67660233-67660255 TTGTGGTCATTGAAAACAAATGG + Intergenic
1026469024 7:70678893-70678915 CTGTGGTTTTTCGAAGCACAGGG + Intronic
1027294142 7:76749541-76749563 CTGTGCTTTTTACAAATCAAAGG + Intergenic
1027878916 7:83807097-83807119 ATGTGGATTTTAAAAGCAAATGG - Intergenic
1028261982 7:88677763-88677785 CTGAGGGTTTTAATCACAAAGGG - Intergenic
1028434723 7:90789231-90789253 CTGTGGTTTTTGAAAGCAAAAGG + Intronic
1028757094 7:94450079-94450101 CAGTGGTAATTAAAACCAAATGG + Intergenic
1030662178 7:112231713-112231735 CTCTGGTTTTAAGAAATAAAAGG - Intronic
1030739304 7:113089093-113089115 CATTGGTTTTTAAAATAAAATGG - Intergenic
1031334119 7:120504979-120505001 CTTTTGCTTTTAAAAATAAAGGG + Intronic
1031890035 7:127283272-127283294 ATGTGATTTTTAAACACAGAGGG + Intergenic
1032157604 7:129481861-129481883 CTTTTGTTTTTTAACACAAATGG - Intronic
1032163322 7:129526984-129527006 CTGTTGCTTTTAAAGACCAATGG - Intergenic
1032562017 7:132902096-132902118 TTGTGGTTTTTGACAAGAAATGG - Intronic
1032657507 7:133947512-133947534 TTGTAGTTTTGAAGAACAAAAGG - Intronic
1032990804 7:137393223-137393245 CTGCTTTTTTTAAAAAAAAATGG - Intronic
1034582076 7:152052776-152052798 CAGAGGTGTTTAAAATCAAAAGG - Intronic
1035879742 8:3232975-3232997 ATGAGGTTTATAAAAACAAATGG - Intronic
1036979976 8:13459742-13459764 CTTTGATTTTTAGAAAAAAAAGG + Intronic
1037109798 8:15152660-15152682 CTTTGCTTTTTAAAAAAACATGG + Intronic
1037202057 8:16267153-16267175 TTGTGTTTATTAAAAAAAAAGGG + Intronic
1038304618 8:26388034-26388056 CTTTTGTTTTTATAAAGAAATGG - Intronic
1038909061 8:31941348-31941370 CTGAGGTTTTTAGTCACAAAGGG - Intronic
1039755788 8:40520569-40520591 CTGTGATTTTTATAAATTAAAGG - Intergenic
1040080425 8:43278622-43278644 CTGTGCTTTTTCAAAAAAAAGGG + Intergenic
1041407610 8:57517487-57517509 CTGATGTTTTAAAAAAGAAAGGG + Intergenic
1041803032 8:61820587-61820609 CTGAGGTGTATAAAAAGAAAAGG - Intergenic
1042159308 8:65876124-65876146 AAGTGATTTTTAAAAACCAAAGG - Intergenic
1042400916 8:68345953-68345975 CTTTGGTTGTTAAATACAACTGG - Intronic
1042635686 8:70871350-70871372 CTGGGTTTTTTAAAAATCAAAGG + Intergenic
1042938721 8:74086535-74086557 CTTTGGTTTATAAATGCAAAAGG - Intergenic
1043471904 8:80571464-80571486 TTGGGTTTTTTAAAAAAAAATGG + Intergenic
1043577276 8:81672581-81672603 CTCAGGTTTTTAAAGAAAAAGGG - Intronic
1043603477 8:81970506-81970528 CAGTGTCTTCTAAAAACAAAAGG - Intergenic
1044395941 8:91712636-91712658 CTGTGGTTTCTAGAGACCAAAGG + Intergenic
1044510178 8:93067359-93067381 ATGTGGTTTATAAACACAATGGG + Intergenic
1045581702 8:103488286-103488308 CTGTGGCTTTCTGAAACAAAAGG - Intergenic
1045682702 8:104679764-104679786 TTGTGGTTTATGAAAGCAAAGGG - Intronic
1045732219 8:105255708-105255730 CTGTGGCTTTTCCAAGCAAACGG + Intronic
1046082787 8:109392500-109392522 CTGTTGGCTTTAAAAAAAAATGG - Intronic
1046331560 8:112722284-112722306 CTTAGGTTTTTTAAAAAAAAAGG + Intronic
1046460157 8:114523213-114523235 CTTTCATCTTTAAAAACAAACGG - Intergenic
1046499801 8:115060795-115060817 TTGTGGTTTTAAATAACAATAGG + Intergenic
1046523139 8:115351142-115351164 CAGTGATTTTTAAAATCAAGTGG - Intergenic
1047301863 8:123620280-123620302 CTGTGTTTTTTAAAAACATCAGG + Intergenic
1047650468 8:126914683-126914705 CTGTGCTTCTTACAAGCAAAAGG + Intergenic
1048845334 8:138599716-138599738 CTCTGTTTTTTAAAAAAGAAAGG + Intronic
1049092406 8:140525981-140526003 CTGTGTTCTTTTCAAACAAAGGG + Intergenic
1050008497 9:1160169-1160191 GTGTGGTTTTTAGAATCAGATGG + Intergenic
1050290076 9:4144991-4145013 CTGCAGTTGTTAAAAACAAAAGG - Intronic
1050733059 9:8731664-8731686 CTGTGGTTTGTGAAAGCACATGG - Intronic
1051037165 9:12762378-12762400 CTGTGGATTTTAAAAATAAAGGG + Intergenic
1051037875 9:12770777-12770799 ATGTAATTTTTAAAAAAAAATGG - Intergenic
1052238339 9:26240716-26240738 CAGTAGTTTTGAAAGACAAATGG + Intergenic
1052676076 9:31626452-31626474 CTGGGTGTTTTAATAACAAAAGG - Intergenic
1054966439 9:71033116-71033138 ATGTGGTATTTAAAAAGAAAGGG + Intronic
1055037979 9:71838485-71838507 AAGTGGTTGTTAAAAAAAAAGGG + Intergenic
1055240139 9:74173969-74173991 CTGTTGTATTTAAGAAAAAATGG + Intergenic
1055655966 9:78450890-78450912 CTGGGTTTTTAAAAAACAAAGGG - Intergenic
1055777018 9:79777650-79777672 CTGTAGGTTTTAATACCAAAGGG - Intergenic
1056346817 9:85705274-85705296 CAGTGATTTTTAAAAGAAAATGG + Intronic
1056605765 9:88083518-88083540 CTCTGGTTTTCAAAGAAAAAAGG + Intergenic
1056992701 9:91425195-91425217 TTTTGCTTTTTAAAAACGAAAGG - Intergenic
1057237434 9:93373557-93373579 CTTTGGTGTTTTAAAACATATGG - Intergenic
1057554300 9:96075352-96075374 GAGTGCTTTTTAAAAACAAATGG - Intergenic
1057702372 9:97372988-97373010 CTGTTGTGTGAAAAAACAAATGG + Intronic
1057715548 9:97492455-97492477 GTGTGGTTTTTGAAGTCAAAAGG + Intronic
1058325531 9:103692551-103692573 CTGTGGATTTTAAGCAGAAAGGG - Intergenic
1058366250 9:104212319-104212341 CTGTGCTTTCTAAATAAAAAAGG - Intergenic
1060654769 9:125363089-125363111 CTGTTCTTTTTTAAAATAAAAGG - Exonic
1060870551 9:127036463-127036485 CTGTTGTTATGAAGAACAAATGG + Intronic
1062096081 9:134704410-134704432 GTGTGGTTTTCAAAAGGAAATGG + Intronic
1186173811 X:6904484-6904506 CTGTGGTTTATAGGAACAAGGGG + Intergenic
1186569760 X:10701962-10701984 CTATGATTTTTAAAAATGAAAGG + Intronic
1186633199 X:11373500-11373522 TTGTGGATTTGAAAAACAGAAGG + Intronic
1186882455 X:13879987-13880009 CTCTGGTCTTCATAAACAAAAGG - Intronic
1187068743 X:15866747-15866769 CTGTATTTTTTAAATACAGATGG - Intergenic
1188075334 X:25768817-25768839 CTGTGGTGTTGAAAAAGAACAGG + Intergenic
1188182245 X:27070410-27070432 CTGTCTTTTTAAAATACAAAAGG - Intergenic
1188230336 X:27655073-27655095 CTCTGGTTTTTAAATACTCAAGG + Intronic
1188287953 X:28352210-28352232 CTGTGGTTTTAAAAGATACATGG + Intergenic
1188324146 X:28778848-28778870 CTGTGGCTTATAAAAATAAAAGG + Intronic
1188675342 X:32933138-32933160 ATGTATTTTTAAAAAACAAATGG + Intronic
1189539956 X:41976697-41976719 CTATTATTTATAAAAACAAAAGG + Intergenic
1189549064 X:42074475-42074497 CTCTGCTTTTAAAAAATAAAGGG + Intergenic
1190890933 X:54567123-54567145 CTATGCTTTTTAAAAAAATATGG + Intergenic
1192024972 X:67440237-67440259 CTGTTTATTTTAAAGACAAATGG + Intergenic
1192298396 X:69874444-69874466 CTGAGGGTTTTAAACATAAAGGG - Intronic
1192666291 X:73090385-73090407 CTGTATTTTATAAAGACAAAAGG - Intergenic
1192991580 X:76464057-76464079 CTGTGGGTTTTAATCATAAAGGG + Intergenic
1193012524 X:76692862-76692884 AGGTGTTTTTCAAAAACAAAAGG - Intergenic
1193636107 X:83950752-83950774 CTGAGGTTTTTAATCATAAAGGG - Intergenic
1194141254 X:90213203-90213225 CTGTGCTTTTTAGAAAATAAAGG - Intergenic
1194214004 X:91106072-91106094 CTGAGGGTTTTAAACATAAAGGG + Intergenic
1194526617 X:94984446-94984468 CTGTGGTTTTTAAAGACTCATGG - Intergenic
1194550204 X:95288908-95288930 CTGCTATATTTAAAAACAAATGG + Intergenic
1194627786 X:96246007-96246029 CTGTGATTTAAAAAAACAGAAGG + Intergenic
1194881577 X:99258248-99258270 CTGGGGGTTTTAATCACAAAGGG + Intergenic
1197215445 X:123862545-123862567 TTGTGGTTTATTAAAAAAAAGGG - Intronic
1197334933 X:125202385-125202407 TTTTGGTCTTTAAAACCAAATGG + Intergenic
1197480740 X:126982542-126982564 CTCTGGTTTTAAAAAAAAAAAGG - Intergenic
1197607336 X:128599203-128599225 CTATGTTTTTAAAAATCAAAAGG + Intergenic
1197692815 X:129522294-129522316 CTGAGTTTTTTAAAAATTAAAGG + Intronic
1197797274 X:130311375-130311397 CTGTGGTATTCAAAAGCAAAAGG - Intergenic
1197814185 X:130479692-130479714 CTGTGGTTAAAAAAAAAAAAAGG - Intergenic
1198041246 X:132854661-132854683 CTGCAGTTTTTAAAAGCAGAAGG - Intronic
1198509910 X:137340096-137340118 GTGTGGATTTTAAAAAGAAGGGG + Intergenic
1198601560 X:138289433-138289455 TTGAGGATTTTAAAAAGAAAAGG + Intergenic
1199287295 X:146067849-146067871 CAGTAGTCTTTAAGAACAAATGG + Intergenic
1199424593 X:147686168-147686190 CTGGGGTTTTTAATCATAAAGGG - Intergenic
1200163707 X:154021944-154021966 CTGATATATTTAAAAACAAAAGG - Intronic
1200316035 X:155134239-155134261 CTGGGGGTTGTCAAAACAAATGG + Intronic
1200753653 Y:6969810-6969832 CTGTGGATTTTAAAAAAAAAAGG + Intronic
1201254103 Y:12090032-12090054 CTGTGGTTTTTAACAAAGACAGG + Intergenic