ID: 1023896015

View in Genome Browser
Species Human (GRCh38)
Location 7:44433625-44433647
Sequence TGCTGGTTGCCTCATACCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023896015 Original CRISPR TGCTGGTTGCCTCATACCCA TGG (reversed) Intronic
900702235 1:4055555-4055577 TGCTCTGTGCCTCATACACACGG - Intergenic
901965084 1:12859788-12859810 TGCTGTCTGCCTCTTACTCATGG - Exonic
901973469 1:12926259-12926281 TGCTGTCTGCCTCTTACTCATGG - Intronic
901980473 1:13030142-13030164 TGCTGTCTGCCTCTTACTCATGG - Intronic
901988962 1:13097171-13097193 TGCTGTCTGCCTCTTACTCATGG + Intergenic
901992851 1:13129596-13129618 TGCTGTCTGCCTCTTACTCATGG - Intergenic
902001615 1:13198789-13198811 TGCTGTCTGCCTCTTACTCATGG + Intergenic
902011710 1:13275508-13275530 TGCTGTCTGCCTCTTACTCATGG + Intergenic
902020844 1:13344499-13344521 TGCTGTCTGCCTCTTACTCATGG + Exonic
908907512 1:69033279-69033301 TGCTGGATGCCCCATAGTCAGGG - Intergenic
911564857 1:99452018-99452040 GGCTGATTGCCTAATACCCCCGG + Intergenic
912696920 1:111848870-111848892 CGCTGGCTGCCTCATCCACAGGG + Intronic
913368964 1:118075344-118075366 GGCTGTTTGCTTCATAGCCAAGG - Intronic
915231086 1:154445786-154445808 TGCTTGTTGCCTCAGAACCATGG - Intronic
918168693 1:181974959-181974981 TGCTGGTTGCCCCTTTCCCCAGG - Intergenic
919128137 1:193421673-193421695 TGCCTCTTGCCTCATATCCAGGG + Intergenic
923184575 1:231558295-231558317 TGCTGGCTGCCCCATACTCAGGG + Intronic
923500411 1:234559589-234559611 TGCTGGCTGCCTCCTGCACAAGG - Intergenic
923758495 1:236816839-236816861 TTCTGGTTGCCTCATAAATAGGG - Intronic
924811425 1:247405870-247405892 TGCTGGAAGCCTCATCACCAAGG - Intergenic
1065657366 10:27965580-27965602 TCCTGGGTTCCTCTTACCCATGG - Intronic
1066289384 10:33999863-33999885 TGCTGGTTGCCTGACATCCCTGG + Intergenic
1069266603 10:66466200-66466222 GGCTGGTAGCCTAAGACCCAGGG - Intronic
1070781971 10:79142864-79142886 TGCTCGGTGCCTCTTCCCCATGG - Intronic
1070889189 10:79929594-79929616 TGCTGGTTGCCTCCAAGACAAGG + Intergenic
1071134608 10:82438496-82438518 TGCTGGCTGCCCCTTCCCCAAGG + Intronic
1073323923 10:102631700-102631722 AGCTGGTGCCCTCATACCCCTGG - Exonic
1075397937 10:122141308-122141330 CGCCTGTTGGCTCATACCCAGGG - Intronic
1075791299 10:125086131-125086153 TGCTGAAAGCCTCATCCCCAAGG + Intronic
1076275690 10:129196625-129196647 TGCTGTTTCCCTCTTCCCCAGGG + Intergenic
1079363632 11:19790742-19790764 TGCTGGTTGCCTCACACCTTGGG - Intronic
1084013048 11:66363303-66363325 TGCTGGCAGCCTCAGGCCCAGGG + Exonic
1084166768 11:67378738-67378760 GGCTAGATGCCTCATAGCCAGGG - Intronic
1084913031 11:72406636-72406658 GGCAGGTTGGCTAATACCCAGGG + Intronic
1088872958 11:113908320-113908342 TGCTGGATCCCTCATACCTTTGG + Intronic
1089614123 11:119685619-119685641 TGCTGGCTGCCCCATCCACATGG + Intronic
1089861436 11:121593505-121593527 TGCTGTGTGCCTGTTACCCAGGG + Intronic
1090912757 11:131135740-131135762 TCCTGGCTGGCTCAGACCCATGG - Intergenic
1092650032 12:10624811-10624833 TCCTGGCTGCCACATCCCCATGG + Exonic
1092664403 12:10779373-10779395 TGCTGGTTGTCTGAGACCCTGGG + Intergenic
1105254937 13:18738139-18738161 AGCTGGTTTCCTCCTCCCCAGGG - Intergenic
1106923447 13:34588864-34588886 TGCTGGGTGGTTCATACCCTGGG - Intergenic
1108815693 13:54287332-54287354 TGCTGGTTGCCCCTTCCCCCAGG + Intergenic
1110582189 13:77143527-77143549 TGCAGGTAGCCTCAGAACCAGGG - Intronic
1113961723 13:114130087-114130109 TGCTGCTGGCCTGATACCCCGGG - Intronic
1118476936 14:66126255-66126277 AGCTGTTTCCCTCGTACCCATGG - Intergenic
1122089165 14:99326741-99326763 GGCTGGTTTCCTCATCGCCAGGG + Intergenic
1122939797 14:104976161-104976183 GGCAGGTTGCCTCTTTCCCAGGG - Intronic
1124647244 15:31446901-31446923 TGCTGGATGCCTCATATAAATGG + Intergenic
1127975719 15:63995816-63995838 TGCTGGTTGCCTCACAGCTGTGG - Intronic
1132064343 15:98718323-98718345 TGTCGGTTGCTTGATACCCATGG + Intronic
1132937096 16:2486676-2486698 TGCTGTGGGCCTCATCCCCAGGG + Intronic
1133620643 16:7522993-7523015 TCCTCCTTGCCTCATCCCCAGGG + Intronic
1134807576 16:17138956-17138978 TGATGGTTGCATTAGACCCAGGG + Intronic
1144930387 17:18854293-18854315 TCCTCGGTGCCTCATACTCATGG + Intronic
1148819839 17:50354073-50354095 GGCTGGGAGCCTCATGCCCAAGG + Exonic
1150218595 17:63483626-63483648 TCCTAGCTGCCTCATCCCCAGGG + Intergenic
1150580195 17:66466371-66466393 TGCAGGTGGCCTCAAACGCAGGG - Intronic
1150946991 17:69758280-69758302 GGGTGGGTGCCTCATACCCATGG + Intergenic
1152689849 17:81712936-81712958 TGCTGGCTGTAGCATACCCAGGG + Intronic
1154300469 18:13186865-13186887 TGCTGCTTGCCTCTGACCCATGG - Intergenic
1154436091 18:14342467-14342489 AGCTGGTTTCCTCCTCCCCAGGG + Intergenic
1159582788 18:70251291-70251313 TGATGGTTGCCTGACACCCCTGG + Intergenic
1159994496 18:74950534-74950556 TGCTGATTTCCTCTTATCCAAGG + Intronic
1163410494 19:17150881-17150903 TGCTGGTACCCTCAGACTCAAGG + Intronic
925672397 2:6325473-6325495 TGCAGGTTTCCTCTTACACATGG - Intergenic
925751752 2:7095659-7095681 AGCTGGTCACCTCATACACAGGG + Intergenic
926693540 2:15754370-15754392 TGCTGGATGCCTCATCATCATGG + Intergenic
929710701 2:44263654-44263676 TGCTGGTTGCCTGATATTCCTGG + Intergenic
933938500 2:87226141-87226163 AGCTGAGTCCCTCATACCCAAGG + Intergenic
933993010 2:87647155-87647177 TGCTGGGTGCCACAGAACCAGGG - Intergenic
936300847 2:111303724-111303746 TGCTGGGTGCCACAGAACCAGGG + Intergenic
936354635 2:111739633-111739655 AGCTGAGTCCCTCATACCCAAGG - Intergenic
940522781 2:154771901-154771923 TAGTGGTGGCTTCATACCCACGG + Intronic
946526583 2:220527296-220527318 TGCTGTTTGCCAGATTCCCAGGG - Intergenic
1169825129 20:9759430-9759452 TGCTTGTTGCCTCACACCTATGG + Intronic
1171392858 20:24812250-24812272 TGCTGCCTGCCCCATACCCCAGG + Intergenic
1176840945 21:13843168-13843190 AGCTGGTTTCCTCCTCCCCAGGG - Intergenic
1178488292 21:33032509-33032531 TGCTGGCTGCCTCCAAACCAGGG - Intergenic
1182692042 22:32171036-32171058 TGCTGGTTGCCAACAACCCAAGG - Intergenic
1183383485 22:37502189-37502211 TGCTGGGTGGCTCAGTCCCAGGG + Intronic
1184714732 22:46274497-46274519 TGCTGGTTCCCTCATTCTCCGGG + Intronic
949585079 3:5429257-5429279 TGCTGTTTGCTTCACACACAAGG - Intergenic
950101149 3:10357751-10357773 TGCACGCTGCCTCATGCCCATGG + Intronic
951915651 3:27798220-27798242 TGCAGGCTGCCTCAGACCCCTGG + Intergenic
955701467 3:61686057-61686079 TGCTCGTTACCTCATTCCCGTGG + Intronic
955725246 3:61925893-61925915 TGCTGGTTACCTCATCAACAGGG - Intronic
957275013 3:78080207-78080229 TGATGGTTGCCTAATATCCTTGG - Intergenic
958656526 3:97009619-97009641 TGCTGGTTGCCCCTCCCCCAAGG + Intronic
960303289 3:116030682-116030704 TGCTATTTGCCACCTACCCAAGG - Intronic
960588179 3:119340666-119340688 GGCTGGGTACCTCATATCCATGG - Intronic
960962370 3:123081127-123081149 TGCGGGTGGCCACATGCCCAGGG + Intronic
962265001 3:133938546-133938568 GGCTGGCTGCCCCTTACCCAAGG - Intronic
962691890 3:137907435-137907457 TGGTGGTTGCCCCTTCCCCAAGG - Intergenic
963139731 3:141937549-141937571 TGCTGGTTTTCTCATCCCCTCGG + Intergenic
963179413 3:142338429-142338451 TGCTGGTTGTTTCAGTCCCAAGG - Intronic
964422801 3:156521808-156521830 TACTGCTTTCCTCATACCAAAGG - Intronic
964647432 3:158973412-158973434 TGATGGTTACCTCATCCTCAGGG - Intronic
964831169 3:160885833-160885855 TGCTGGTTGCCCCTCCCCCAGGG - Intronic
972249737 4:37287274-37287296 TGCTGGTTGCCCCTTTCCCTGGG - Intronic
972411150 4:38796062-38796084 TGATGCTTTCCTCATATCCATGG - Intronic
973004899 4:44994122-44994144 TGCTGGATATATCATACCCAAGG + Intergenic
974271429 4:59656068-59656090 TGCTGGTCGCCTCTTCCCCAGGG - Intergenic
975715853 4:77205375-77205397 TGCTGATGGCCTCATATCCAGGG + Intronic
976056778 4:81078291-81078313 TGCTGTTTGGCTGATACTCATGG - Intergenic
976618905 4:87107865-87107887 TGCTGGGTGCTTCATATCAAGGG - Intronic
980911079 4:138995101-138995123 TGCTATTTGCCTGGTACCCACGG + Intergenic
985661448 5:1159060-1159082 TTCTGGCAGCCTCAAACCCAGGG - Intergenic
985830712 5:2227467-2227489 TGCTGGTGTCCTCATCCACAGGG - Intergenic
990328196 5:54698800-54698822 TCCTGGGTGGCTCATATCCAGGG - Intergenic
995191358 5:109322102-109322124 TGCTGGTTGCCTGACACTCCTGG - Intergenic
997275750 5:132587015-132587037 AGCTGGTTGCCTCATCTCCCAGG - Intronic
998817874 5:146031950-146031972 TGCTGCTTGTCTCTTACCCCTGG - Intronic
998977417 5:147663426-147663448 TGCTGGATGCCTCCTGCCCTTGG + Intronic
999827567 5:155288741-155288763 GGCTGGTTTCCACATTCCCAAGG - Intergenic
1000010048 5:157222554-157222576 TGCTGGATGCATCATGCCCTTGG - Intronic
1000784882 5:165530621-165530643 TGCTGGTTGCCCCATCACCCAGG + Intergenic
1001880943 5:175243582-175243604 TGGTGGTTGCCACTGACCCACGG - Intergenic
1001951753 5:175821176-175821198 TGATGGTTTCCCCATCCCCAGGG + Intronic
1002344116 5:178536080-178536102 TGCTGGTGGCCTCAGAGCCAGGG - Intronic
1004180703 6:13378499-13378521 AGCTGGTTGCTCCATATCCATGG + Intronic
1006341603 6:33450232-33450254 TGCTGGGTATCTCATACCCAAGG + Intronic
1010563817 6:77384179-77384201 TGCTGGATGCTTCCTACCCTTGG - Intergenic
1012342649 6:98146829-98146851 TGCTGCTGGGCACATACCCAAGG + Intergenic
1012964297 6:105656770-105656792 TGCTGTTTCCCCCATAGCCAGGG + Intergenic
1014866312 6:126534595-126534617 TACTGTTTGCCTCACACCAAGGG + Intergenic
1015478172 6:133676856-133676878 GGTTGGTTCCCTCATAGCCAAGG - Intergenic
1015808245 6:137133741-137133763 TGCCTGATGCCTCATCCCCAGGG + Intergenic
1018235112 6:161716427-161716449 TGCTGGTAGCTTCAAAACCATGG + Intronic
1020214929 7:6182883-6182905 TGCTGGTTTCCTCAAACGCTTGG + Intronic
1022120778 7:27306044-27306066 TGTTAGTTACCTGATACCCATGG - Intergenic
1023896015 7:44433625-44433647 TGCTGGTTGCCTCATACCCATGG - Intronic
1024093692 7:45968014-45968036 GCCTGGTTGCCTCACCCCCAAGG + Intergenic
1024236898 7:47405784-47405806 TGCTGGTTGTTTCTTACCGAGGG - Intronic
1024612373 7:51078673-51078695 TGCTGGGTGCCTCTGACTCATGG + Intronic
1024765569 7:52654325-52654347 TGCCTGTTGCCTCATACCTCAGG + Intergenic
1027917685 7:84347148-84347170 CACAGATTGCCTCATACCCAGGG + Intronic
1028947688 7:96599460-96599482 GGCTACTTGCCTCATTCCCAAGG + Intronic
1031023049 7:116649394-116649416 TGCTGGTTCCATAATAACCAGGG + Intergenic
1032097808 7:128948145-128948167 TCCTGGCTGCCTCTTGCCCAGGG + Intronic
1032650575 7:133873760-133873782 TGTTGGTTGTCTCCTTCCCAGGG + Intronic
1032933316 7:136699108-136699130 TGCTGGCTGTCTGATACCAATGG - Intergenic
1034018247 7:147610479-147610501 TGCTGGTTGCTTCAAACTGAGGG - Intronic
1034938828 7:155217012-155217034 AGCTGGCTGACCCATACCCAGGG + Intergenic
1035482873 7:159201681-159201703 TTCTGTTTGCCTCAGACACAAGG + Intergenic
1037815075 8:22107831-22107853 TGCAGGCTGCCTGGTACCCACGG - Exonic
1039787606 8:40847624-40847646 TGCTGGCTGCCTCAAGCCTAAGG - Intronic
1040444819 8:47482975-47482997 TGCTGGCTGCCCCCTCCCCAAGG + Intronic
1044271813 8:90253407-90253429 TTCTGGGAGCCTCAGACCCAAGG + Intergenic
1044743083 8:95347317-95347339 TTCTGGTGGCCTCATGCACAAGG + Intergenic
1046510231 8:115193042-115193064 TGGTGGTGGTCTCCTACCCATGG + Intergenic
1048777705 8:137965812-137965834 TGCTGGATGGCACATACTCAGGG + Intergenic
1049284951 8:141769614-141769636 TGCTGGTTCCTTCAGCCCCAGGG - Intergenic
1049316754 8:141973349-141973371 TTCTTGTTGCGTCATCCCCATGG + Intergenic
1050982300 9:12035869-12035891 TGCTGGTTGCCTCTCCCCCTGGG - Intergenic
1056233782 9:84571854-84571876 TGCTGCTGGCCACACACCCAGGG - Intergenic
1062568525 9:137173862-137173884 TGCTGGTTCCCACATGTCCACGG - Intergenic
1062695951 9:137876653-137876675 TGCCTGTTGCCTCATGCCCCAGG - Intergenic
1189262154 X:39686786-39686808 CCCTGGCTGCCTCATCCCCAAGG + Intergenic
1201737832 Y:17288763-17288785 TCCTGGTTGCCTCTTTCCTAAGG + Intergenic