ID: 1023898571

View in Genome Browser
Species Human (GRCh38)
Location 7:44455513-44455535
Sequence CCCTCCAAGCCCAATCCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 206}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023898562_1023898571 30 Left 1023898562 7:44455460-44455482 CCCAGGACTGCTACCTCTTCCAC 0: 1
1: 0
2: 1
3: 20
4: 226
Right 1023898571 7:44455513-44455535 CCCTCCAAGCCCAATCCTTCAGG 0: 1
1: 0
2: 0
3: 17
4: 206
1023898563_1023898571 29 Left 1023898563 7:44455461-44455483 CCAGGACTGCTACCTCTTCCACA 0: 1
1: 0
2: 0
3: 16
4: 176
Right 1023898571 7:44455513-44455535 CCCTCCAAGCCCAATCCTTCAGG 0: 1
1: 0
2: 0
3: 17
4: 206
1023898564_1023898571 17 Left 1023898564 7:44455473-44455495 CCTCTTCCACAAGCTCCTCACAC 0: 1
1: 0
2: 0
3: 24
4: 355
Right 1023898571 7:44455513-44455535 CCCTCCAAGCCCAATCCTTCAGG 0: 1
1: 0
2: 0
3: 17
4: 206
1023898566_1023898571 2 Left 1023898566 7:44455488-44455510 CCTCACACAAAACCTTTCCCTCT 0: 1
1: 0
2: 1
3: 37
4: 356
Right 1023898571 7:44455513-44455535 CCCTCCAAGCCCAATCCTTCAGG 0: 1
1: 0
2: 0
3: 17
4: 206
1023898567_1023898571 -10 Left 1023898567 7:44455500-44455522 CCTTTCCCTCTTTCCCTCCAAGC 0: 1
1: 0
2: 7
3: 119
4: 976
Right 1023898571 7:44455513-44455535 CCCTCCAAGCCCAATCCTTCAGG 0: 1
1: 0
2: 0
3: 17
4: 206
1023898565_1023898571 11 Left 1023898565 7:44455479-44455501 CCACAAGCTCCTCACACAAAACC 0: 1
1: 0
2: 0
3: 14
4: 241
Right 1023898571 7:44455513-44455535 CCCTCCAAGCCCAATCCTTCAGG 0: 1
1: 0
2: 0
3: 17
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023898571 Original CRISPR CCCTCCAAGCCCAATCCTTC AGG Intronic
901571541 1:10164963-10164985 CCCTCCTACCCCCAGCCTTCAGG + Intronic
902716513 1:18276451-18276473 ATCTCCAAGCCCAAGCCTTAGGG - Intronic
903853467 1:26321756-26321778 CCCTCCAGGCCCCAGCTTTCGGG - Intergenic
904684707 1:32251667-32251689 ACCACCAAGCCCAGTCCCTCAGG + Intronic
905159071 1:36015366-36015388 CTCTCCAAACCCCATCCTTTTGG + Intronic
905653696 1:39672565-39672587 CCCTCCGAGGCCAGTCCATCCGG + Intergenic
905869923 1:41397522-41397544 GCCTGCAATCCCAATGCTTCGGG - Intergenic
906491289 1:46270826-46270848 CCATCCATGGCCAATCCTTTGGG + Intronic
906532977 1:46533908-46533930 CCCTCCAACCCCTCTCCTCCAGG + Intergenic
907012144 1:50973749-50973771 CCCTTCAAGCCCCATCCTATGGG + Intronic
907361596 1:53920705-53920727 GCCTGCAAACCCAATGCTTCGGG + Intronic
907976012 1:59432125-59432147 CTCTCCAAACCCCATCTTTCAGG - Intronic
910953005 1:92671618-92671640 CCCACTAAACCAAATCCTTCTGG + Intronic
913671885 1:121104894-121104916 CTCTCCAAGCCCTGTCCTTTTGG + Intergenic
914662136 1:149800284-149800306 CTCTCCAAGCCCTGTCCTTTTGG + Intronic
914751433 1:150537669-150537691 CTCTCCCAGCCCAAACCCTCTGG - Intergenic
916027664 1:160848719-160848741 CTCTCCAAGCCCAGTCCTCTTGG - Intronic
919901312 1:202046189-202046211 CCCTCCAACCACTAGCCTTCAGG - Intergenic
920557593 1:206915353-206915375 CACTCCATACCCATTCCTTCAGG - Intronic
920703580 1:208235751-208235773 CCCTCCCAGCACAATCCTGCAGG - Intronic
921555721 1:216596513-216596535 CCCTGCACTCCCAAGCCTTCAGG - Intronic
921933326 1:220773264-220773286 CTCTCCAAACCCCATCTTTCAGG - Intronic
922798936 1:228355308-228355330 CCCTCCCAGCCCAAGCCAGCTGG - Intronic
922861502 1:228821182-228821204 CCCTCCAAGACCTTGCCTTCTGG - Intergenic
923990539 1:239432039-239432061 CCCTCATAGCCACATCCTTCCGG - Intronic
924224113 1:241906904-241906926 CCCTGTAATCCCAATCCTTTGGG + Intergenic
924510410 1:244725186-244725208 CCCCACAAGCCCCTTCCTTCAGG + Intergenic
924924617 1:248667053-248667075 CCCTGCAAAGCCAATTCTTCTGG + Intergenic
1063446947 10:6124895-6124917 CCCGCTAATGCCAATCCTTCGGG + Intergenic
1063521929 10:6748925-6748947 CCCCCCAAGCCCCATTATTCAGG + Intergenic
1064286800 10:13998678-13998700 CCCTCCACACCCAATCTGTCAGG + Intronic
1066066003 10:31761308-31761330 CCTTCCAAGCCAAAGCCTGCAGG - Intergenic
1066250465 10:33628085-33628107 CTCTTCAACCCCAATTCTTCTGG + Intergenic
1067733201 10:48828782-48828804 GGCTCCAATCCAAATCCTTCTGG - Exonic
1068817835 10:61337488-61337510 CCTTCCAAGTACAACCCTTCAGG + Intergenic
1069920966 10:71815369-71815391 CCCTCCAAGGCCAGGCCTTGGGG + Exonic
1072160045 10:92757489-92757511 CCCTCTCAGCTCAATTCTTCAGG + Intergenic
1074440747 10:113475483-113475505 CCCTCCCAGCCCTCTCCCTCTGG - Intergenic
1077281942 11:1749772-1749794 CCCACCAAGTCCAGGCCTTCCGG + Intronic
1077549375 11:3193274-3193296 CCCTCCAAGCCCGGTCATTCAGG + Intergenic
1079304655 11:19311601-19311623 CCCTCAAAACCGAATCCTTGTGG + Intergenic
1080828318 11:35866942-35866964 ACCTCCAACCTCAATCCTTATGG + Intergenic
1081750851 11:45510235-45510257 CTCTCCAAACCCATTCCTCCAGG + Intergenic
1083127011 11:60579796-60579818 CACTCCATACCCAATCCATCAGG - Intergenic
1083707195 11:64524772-64524794 CTCTCCAAACCCAGTCCTTTTGG - Intergenic
1085452673 11:76644851-76644873 CTCTCCAAACCCAGTCCTTTCGG - Intergenic
1089503989 11:118951282-118951304 ACCTCCAAATCCAATCCTCCAGG + Intronic
1090013249 11:123062892-123062914 CCCTCCAATCCCAATCCTGGGGG - Intronic
1090245339 11:125212336-125212358 TCCTCCAGGACTAATCCTTCTGG + Intronic
1090389921 11:126381971-126381993 CCCTCCCAGCCCACTCATCCAGG + Intronic
1090493870 11:127190998-127191020 CTCTCCAAGCCCCATCCTTTTGG + Intergenic
1091593970 12:1862670-1862692 CCCTCTAATCCCAACACTTCGGG - Intronic
1091694497 12:2618620-2618642 CCCTGCAAGCTAAATCCATCAGG + Intronic
1091710697 12:2738098-2738120 CCCTCCCCTCCCAATCCTCCTGG + Intergenic
1091713551 12:2760163-2760185 CCCTCCCCTCCCAATCCTTCTGG + Intergenic
1093045261 12:14436430-14436452 CCCTGTAATCCCAATCCTTTGGG + Intronic
1093635282 12:21459290-21459312 CTCTCCAAACCCAGTCCTTTTGG - Intronic
1094099506 12:26746096-26746118 GCCTCCAACCCCTATTCTTCTGG - Intronic
1094692779 12:32786149-32786171 CACACCAAACCCCATCCTTCTGG - Intergenic
1096657496 12:53100816-53100838 CCCTCCCAGCCCAATTCTGCGGG + Exonic
1097067653 12:56332952-56332974 GCCTCCAAGGCCACTCCCTCTGG + Exonic
1098758014 12:74389578-74389600 CCCTCCAGCCCCACTCCTCCAGG - Intergenic
1099810796 12:87579735-87579757 CATTCCAACCCCAATCCATCAGG - Intergenic
1099989486 12:89708310-89708332 CCCAACAAGCCCCATCCCTCGGG + Intronic
1101434230 12:104651500-104651522 CACTCCTACCCCAATCCTTTTGG - Intronic
1103567408 12:121823419-121823441 CCCTCCGAGGCCATTCCTCCGGG + Exonic
1111491471 13:88981713-88981735 CCCTCCAACCCCATTCTTTCCGG - Intergenic
1111601553 13:90481427-90481449 CCATCCAAGTCCAATCCAGCGGG + Intergenic
1113744899 13:112737450-112737472 CCCTGGAAGCCCATCCCTTCTGG - Intronic
1114067238 14:19071934-19071956 CACTCCAAGCCCCATCTTGCTGG - Intergenic
1114095022 14:19328093-19328115 CACTCCAAGCCCCATCTTGCTGG + Intergenic
1115473763 14:33794883-33794905 CCCTCCCACCCCCATCATTCTGG + Intronic
1115567724 14:34639129-34639151 CTCTCCAAACCCTATCCTTGTGG + Intergenic
1116873770 14:50091749-50091771 CCCTCCAAGCCCGAACCTCAGGG - Exonic
1118008020 14:61582716-61582738 CCCTCCAAGCACCAGCCTTTGGG - Intronic
1119540696 14:75436261-75436283 CCCTCCAAGGCCACTCCTGCAGG + Intronic
1119572540 14:75688311-75688333 CTCTCCAAACCCAGTCCTTTTGG - Intronic
1121011386 14:90522217-90522239 CCCTCCCGGCCCAGGCCTTCAGG - Intergenic
1122542323 14:102505339-102505361 CTTTCCAAGCCCAATTCTTGGGG - Exonic
1122783680 14:104154369-104154391 CCCTCCAAGGACCAGCCTTCTGG - Intronic
1129034375 15:72640719-72640741 CCCTGCAAGTCCAGTCCTTGGGG + Intergenic
1129215507 15:74096497-74096519 CCCTGCAAGTCCAGTCCTTGGGG - Intergenic
1129391916 15:75224963-75224985 CCCTGCAAGTCCAATCCTTGGGG + Intergenic
1129472458 15:75763199-75763221 CCCTGCAAGTCCAGTCCTTGGGG - Intergenic
1129732649 15:77940826-77940848 CCCTGCAAGTCCAATCCTTGTGG - Intergenic
1132094435 15:98971225-98971247 CCCTGAAAACCCAATCCTTGGGG + Intronic
1132138440 15:99367772-99367794 CTCTCCAAACCCAGTCCTTTGGG + Intronic
1133381751 16:5336747-5336769 CCCTCCAGCCCCCCTCCTTCTGG + Intergenic
1136108623 16:28050423-28050445 GCCTCCAATCCCAGCCCTTCTGG - Intronic
1136228204 16:28872768-28872790 CCCTCCCCGCCCCATCTTTCTGG - Intronic
1136865802 16:33752193-33752215 CTCTCCAAATCCAATCCTTTTGG + Intergenic
1139827692 16:69770385-69770407 CTCCCCAAACCCAGTCCTTCAGG - Intronic
1141610869 16:85180438-85180460 CCCTCCACTCCCAAGCCCTCGGG + Intronic
1142344097 16:89543021-89543043 CCCTGCAAGCTCCACCCTTCAGG + Intronic
1203106352 16_KI270728v1_random:1363910-1363932 CTCTCCAAATCCAATCCTTTTGG - Intergenic
1203127162 16_KI270728v1_random:1598458-1598480 CTCTCCAAATCCAATCCTTTTGG + Intergenic
1143461953 17:7109470-7109492 CTCTCCAAGCACAACCCTCCAGG + Intronic
1143655173 17:8289630-8289652 CCCTCCCAGCCCGATTCTCCTGG - Exonic
1144949655 17:18987057-18987079 CCCTCCAACCCCAACGCCTCCGG - Intronic
1146138848 17:30347292-30347314 CCCTCCAAACCCTGTCCTTTGGG - Intergenic
1148450587 17:47775323-47775345 CCCTCCAAGACCAATCCCAAGGG + Intergenic
1148623896 17:49054510-49054532 CCCTCCCAGCCCAATCGATATGG - Exonic
1148677272 17:49452610-49452632 CCCTCCCACCCCATTCATTCTGG - Intronic
1151307865 17:73275021-73275043 CCCTCCAACCCAAACCCTTAAGG + Intergenic
1152051330 17:77980932-77980954 CTCTCCAAACCCAATCCTTTTGG + Intergenic
1152794058 17:82298267-82298289 CCCTCCCAGCCCACAACTTCCGG - Intergenic
1153453809 18:5259177-5259199 CCCTCCTAGCCCACTGTTTCTGG - Intergenic
1153663884 18:7351024-7351046 CCCTCTAAGCCCAATGGTCCTGG + Intergenic
1156571845 18:38264496-38264518 CCCTCCAAGGCCACTCCTATTGG - Intergenic
1157698919 18:49747117-49747139 CCCTCCAGACCCTGTCCTTCTGG - Intergenic
1157768206 18:50319471-50319493 CTCTCCAAACCCAGTCCTTTTGG - Intergenic
1160400018 18:78603336-78603358 CTCCCCACGCCCATTCCTTCTGG - Intergenic
1163935460 19:20438667-20438689 CACTTCAAGCCCTATCCATCTGG + Intergenic
926316092 2:11711192-11711214 CCATCCAACCCAAATTCTTCAGG - Intronic
927149537 2:20187715-20187737 CGCTCCATTCCCCATCCTTCAGG - Intergenic
927754566 2:25698366-25698388 CATTCCAAGCCCCTTCCTTCTGG - Intergenic
928294231 2:30068989-30069011 CCCTCCTACCTCAGTCCTTCTGG - Intergenic
931615782 2:64156029-64156051 CCCATCAAGCCCAAGTCTTCTGG - Intergenic
931976523 2:67649800-67649822 CTCTCCATGCCCACTCCTTTAGG + Intergenic
932457175 2:71857272-71857294 CCCTCCATGCCCGCTGCTTCTGG - Intergenic
934025507 2:87998818-87998840 CTCTCCAAGCCCTGTCCTTTTGG - Intergenic
934025946 2:88001738-88001760 CCCTCCAAGCCCTATCTATGGGG + Intergenic
934503237 2:94874618-94874640 CCCACAAAGCCCAGTCCCTCAGG - Intronic
934634324 2:95969060-95969082 CTCTCCAAATCCAATCCTTTTGG + Intronic
934799308 2:97136179-97136201 CTCTCCAAATCCAATCCTTTTGG - Intronic
934834133 2:97567290-97567312 CTCTCCAAATCCAATCCTTTTGG + Intronic
938417048 2:131112226-131112248 CTCCCCAAACCCAATCCTTTTGG - Intronic
939981424 2:148786318-148786340 CCATTTAAGCCCAATCTTTCTGG - Exonic
943015384 2:182503598-182503620 CACACCAAGGCCAATGCTTCAGG + Intronic
943863661 2:192899535-192899557 ATCTCCAAACCCAATCCTTTGGG + Intergenic
946174731 2:217915593-217915615 CCCTCAAATCCCAAGCCTACTGG + Intronic
947264777 2:228266554-228266576 ACCTCCAAGGCAAATCCCTCAGG - Intergenic
947871988 2:233444382-233444404 CCCCCCAAGCACGATGCTTCTGG + Intronic
1169206093 20:3741066-3741088 TCACCCAAGGCCAATCCTTCTGG - Intronic
1173705978 20:45110585-45110607 CCATCCAAGCCCCAAGCTTCAGG - Intronic
1176168500 20:63686671-63686693 CCCTCCCAGCCCTTCCCTTCCGG - Intronic
1177322782 21:19544212-19544234 CTCTCCAAACCCTATCCTTTTGG - Intergenic
1177513761 21:22121985-22122007 CCCTCCAACCCTGCTCCTTCAGG + Intergenic
1179582444 21:42352150-42352172 TCCTCCAGGCCCCATCCTCCAGG + Intergenic
1179879604 21:44287847-44287869 CCGTCCACTCCCTATCCTTCAGG + Intronic
1179905166 21:44418834-44418856 GCCTCCAAGCCGGATCCTGCGGG - Intronic
1180485714 22:15794502-15794524 CACTCCAAGCCCCATCTTGCTGG - Intergenic
1181512141 22:23393860-23393882 CCCGCCGGGCCCCATCCTTCTGG - Intergenic
1181648717 22:24247391-24247413 CCTTCCAAACCCACTCCCTCTGG + Intergenic
1183620761 22:38970973-38970995 ACCTCCTAGCCCACTCCTTGGGG - Intronic
1184371722 22:44086561-44086583 CCCTCCAATCACCTTCCTTCTGG + Intronic
949783439 3:7715198-7715220 ACCTGCAATCCCAATACTTCAGG + Intronic
951532594 3:23711819-23711841 CCCTACAAGCCCTATTCTTTGGG + Intergenic
956370078 3:68549721-68549743 CTCTCCAAACCCTGTCCTTCTGG + Intergenic
957050211 3:75405947-75405969 CTCTCCAAACCCAATTCTTTTGG - Intergenic
958172072 3:89950211-89950233 CCCTGTAATCCCAATACTTCAGG - Intergenic
959570955 3:107883011-107883033 CCCTTCCTGCCCAATCCTGCGGG - Intergenic
959720916 3:109487769-109487791 CCCTGCAAGCTTAACCCTTCAGG - Intergenic
961173194 3:124813744-124813766 CCCTCCAAATCCAGGCCTTCTGG + Intronic
961882525 3:130072384-130072406 CTCTCCAAACCCAATTCTTTTGG - Intergenic
964232483 3:154487071-154487093 CCCACCAAGCTCAATCGTCCCGG - Intergenic
964803727 3:160583683-160583705 CCCTACAATCCCAATACTTTGGG + Intergenic
965315654 3:167187021-167187043 CCCCCAAAGCCAAATACTTCAGG - Intergenic
971563542 4:28112838-28112860 CCCACCAAGCCCATTCCCACCGG - Intergenic
976762958 4:88569744-88569766 TCCTCCCAGCCAAATCCTTAGGG - Intronic
977547580 4:98402329-98402351 CCCTGCAATCCCAACACTTCCGG - Intronic
979191841 4:117870897-117870919 CCTTCCTATCCCAGTCCTTCAGG + Intergenic
982016640 4:151161186-151161208 CCCTCCCTCACCAATCCTTCAGG - Intronic
984180651 4:176478772-176478794 CCCTCCGAGTCCAATGTTTCTGG - Intergenic
985145818 4:186893623-186893645 ACCTCCAGGCCCAATCAATCAGG + Intergenic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
986386306 5:7237568-7237590 CTCTCCATTCCCAAGCCTTCTGG - Intergenic
991915093 5:71597604-71597626 CACTCCATATCCAATCCTTCAGG - Intronic
991917084 5:71615954-71615976 CAGTCCCAGCCCTATCCTTCAGG + Intronic
994186124 5:96817120-96817142 CCCTCCAACCCCAAGTCTTTAGG - Intronic
999392787 5:151206325-151206347 CTCTCCAAACCCAATCCTCTCGG + Intronic
1002422378 5:179155366-179155388 CCCTCCAAGCCCACCTCCTCTGG + Intronic
1002448743 5:179307257-179307279 CCCTGCAAGCCTCAGCCTTCAGG + Intronic
1002892643 6:1348945-1348967 CCTGCCAAGCACAAGCCTTCAGG - Intergenic
1004215674 6:13701914-13701936 CTCTCCAAGACCAACCATTCTGG + Intronic
1004821429 6:19372170-19372192 ACCTCCAGGTCCACTCCTTCAGG + Intergenic
1004931125 6:20464135-20464157 CTCTCCAAACCCAGTCCTTCGGG + Intronic
1007120731 6:39378614-39378636 CCCCCCAGGGCCACTCCTTCTGG + Intronic
1007385772 6:41519450-41519472 CCCTCCAACCCCCATCCAGCAGG + Intergenic
1007934444 6:45720748-45720770 CCCTCCATGTCCAATCTGTCAGG + Intergenic
1008218876 6:48829768-48829790 CACTCCACTCCCAAGCCTTCTGG - Intergenic
1008598608 6:53066332-53066354 CCCTCCAACCCCACTCCGCCAGG - Intronic
1013428276 6:110034293-110034315 CCCACCACTCCCAATCCTCCAGG + Intergenic
1014155516 6:118104841-118104863 CCCTCCAAGTCCAGCCCCTCAGG + Intronic
1016989029 6:149916753-149916775 CTCTCCCAGCCCCCTCCTTCTGG + Intergenic
1018635955 6:165859627-165859649 CTCTCCAAATCCAATCCTTTTGG + Intronic
1019388799 7:773851-773873 TCCTCCAGGCCCAACCCTACCGG - Intronic
1022502544 7:30891854-30891876 GCCTCCAAGACAAAACCTTCAGG + Intronic
1023299887 7:38758852-38758874 CCCTCCAAAGCCACTCCTTTTGG - Intronic
1023898571 7:44455513-44455535 CCCTCCAAGCCCAATCCTTCAGG + Intronic
1025242125 7:57285843-57285865 CCTTCCAGTCCAAATCCTTCCGG + Intergenic
1026498162 7:70921180-70921202 CTCGCCCACCCCAATCCTTCAGG - Intergenic
1029226752 7:99034130-99034152 CCCTCCAAGCCCCAGCCTCCTGG + Intronic
1031811614 7:126376721-126376743 ACCTCAAAGCCCAATCATTCTGG - Intergenic
1033661534 7:143406322-143406344 CCCTCCCAACCCCATCCTTCTGG - Intronic
1034698126 7:153073265-153073287 CCTTCCAAGGCTAATTCTTCAGG - Intergenic
1034939312 7:155220222-155220244 CGCTCCAAGCCCAGTCCCCCAGG + Intergenic
1034965995 7:155391410-155391432 CCCTGCAAACCCACTCCCTCGGG + Intronic
1035600983 8:896547-896569 CCCTCCAAGCACCATCCCACTGG - Intergenic
1035679693 8:1478787-1478809 CCCTCCATTCACAAGCCTTCCGG - Intergenic
1036767750 8:11559668-11559690 CCCTGCAATCACAATCCCTCGGG + Intronic
1036989718 8:13578817-13578839 CCCTCCAAACCCTGTCCTTTAGG + Intergenic
1038491491 8:27975187-27975209 CTCTCCAAACCCAGTCCTTTTGG - Intronic
1039768960 8:40663310-40663332 CCCTCCAACCACAATGCTTTGGG - Intronic
1041730303 8:61055843-61055865 CTCTCCAAGGCCAGTCATTCTGG + Intergenic
1042338199 8:67650903-67650925 TCCTACAAGCCAAAGCCTTCTGG + Intronic
1043420748 8:80095994-80096016 GCCTCCAAGCCCAACACTTTGGG + Intronic
1045584212 8:103513116-103513138 GCCTCCAAGCCCATACATTCTGG - Intronic
1052764618 9:32628491-32628513 CCCTCCAATCCCATTCCTGGGGG + Intergenic
1052933022 9:34071280-34071302 CCATTCAGGCCCAATCCTCCTGG + Intergenic
1053438498 9:38094361-38094383 GCCTCAAAGCCCAATCCTTTAGG - Intergenic
1053441688 9:38121398-38121420 CACTCCATGCCCTAACCTTCCGG - Intergenic
1057953811 9:99391294-99391316 GCCTCCATGCCTAATCCATCAGG - Intergenic
1059142867 9:111870567-111870589 CTCTCCAAACCCTATCCTTTTGG - Intergenic
1060552122 9:124490631-124490653 CCCCCCAAGCCCAGCCCTTGTGG - Intronic
1062082327 9:134630600-134630622 CCCTCCCAGCCCATTCCTCCAGG - Intergenic
1186553630 X:10533614-10533636 GCCTCAAATTCCAATCCTTCAGG + Intronic
1186818771 X:13264878-13264900 CCTTCCACACCCAATACTTCTGG + Intergenic
1186896028 X:14005391-14005413 CTCTCCAAACCCAGTTCTTCTGG - Intergenic
1187192298 X:17046470-17046492 CCGGCCAAGCCTCATCCTTCTGG + Intronic
1192478623 X:71465865-71465887 CCCTCCAATCCCATTCCTGGGGG - Exonic
1195087268 X:101424180-101424202 CTCTCCAAACCCAATTCTTTCGG - Intronic
1196375358 X:115027157-115027179 CTCCCCAAACCCAGTCCTTCTGG + Intergenic
1202586183 Y:26430384-26430406 CTCTCCAAATCCAATCCTTTTGG - Intergenic