ID: 1023899878

View in Genome Browser
Species Human (GRCh38)
Location 7:44467487-44467509
Sequence TGGGTTCTAACTTGGCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 138}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023899878_1023899887 9 Left 1023899878 7:44467487-44467509 CCAGGCTGCCAAGTTAGAACCCA 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1023899887 7:44467519-44467541 ATCAAGGGACAAGTCAGAGGTGG No data
1023899878_1023899880 -7 Left 1023899878 7:44467487-44467509 CCAGGCTGCCAAGTTAGAACCCA 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1023899880 7:44467503-44467525 GAACCCAAGCTCCCAGATCAAGG No data
1023899878_1023899889 26 Left 1023899878 7:44467487-44467509 CCAGGCTGCCAAGTTAGAACCCA 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1023899889 7:44467536-44467558 AGGTGGAGCTCTTTGATCAAGGG No data
1023899878_1023899886 6 Left 1023899878 7:44467487-44467509 CCAGGCTGCCAAGTTAGAACCCA 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1023899886 7:44467516-44467538 CAGATCAAGGGACAAGTCAGAGG No data
1023899878_1023899881 -6 Left 1023899878 7:44467487-44467509 CCAGGCTGCCAAGTTAGAACCCA 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1023899881 7:44467504-44467526 AACCCAAGCTCCCAGATCAAGGG 0: 1
1: 0
2: 2
3: 10
4: 154
1023899878_1023899890 27 Left 1023899878 7:44467487-44467509 CCAGGCTGCCAAGTTAGAACCCA 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1023899890 7:44467537-44467559 GGTGGAGCTCTTTGATCAAGGGG 0: 1
1: 0
2: 1
3: 8
4: 127
1023899878_1023899888 25 Left 1023899878 7:44467487-44467509 CCAGGCTGCCAAGTTAGAACCCA 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1023899888 7:44467535-44467557 GAGGTGGAGCTCTTTGATCAAGG 0: 1
1: 0
2: 1
3: 7
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023899878 Original CRISPR TGGGTTCTAACTTGGCAGCC TGG (reversed) Intronic
902358566 1:15927263-15927285 TGGTTTGTTAGTTGGCAGCCTGG + Intronic
903537184 1:24074690-24074712 TGGATTCTAGCCTGGCTGCCAGG - Intronic
903795267 1:25923748-25923770 TGTGTTTTAACTTGTCAGCCAGG + Intergenic
903953187 1:27008278-27008300 TGGGTGCTGACTTGGCAGCAAGG - Intronic
906376297 1:45299476-45299498 TGGGTTCTAATTGAGGAGCCAGG - Intronic
906691269 1:47794304-47794326 TGGGCTCTCACATGGCTGCCTGG + Intronic
908842309 1:68292563-68292585 TGCATTCTAACTTAGCAACCAGG - Intergenic
910289581 1:85587509-85587531 TAGCTTCTTACTTGGCACCCAGG + Intergenic
910805124 1:91182055-91182077 TGTGTTCTCACTTGGCAGAAGGG + Intergenic
912942249 1:114055741-114055763 TGGGACCCAACTGGGCAGCCAGG + Intergenic
916177940 1:162058163-162058185 TGCATTATGACTTGGCAGCCTGG + Intergenic
918215396 1:182389091-182389113 TAAGTTCTAGCTTGGAAGCCTGG - Intronic
922640558 1:227226249-227226271 TGGGTTCTGACTTGGAATCTCGG - Intronic
1066272549 10:33837643-33837665 TGGGTTCTTGTTTGGCATCCAGG - Intergenic
1068318830 10:55383033-55383055 CAGGTTCTAACTTGGCCTCCAGG + Intronic
1070982630 10:80661865-80661887 TGGGTCCAACCTTGGCAGCCAGG + Intergenic
1071505538 10:86229370-86229392 TGGCTTTAACCTTGGCAGCCTGG - Intronic
1072210872 10:93246114-93246136 TCGGTTCAGAGTTGGCAGCCTGG - Intergenic
1074442108 10:113487149-113487171 TGGTTTCTGAGATGGCAGCCTGG + Intergenic
1078105078 11:8353300-8353322 TGGGTTCTGACTAAGCAGCTTGG + Intergenic
1080728424 11:34920463-34920485 AGGATTCCAAGTTGGCAGCCAGG + Intronic
1090239072 11:125169367-125169389 TGGGTTCTATCCAGGCAGCATGG + Intronic
1094376625 12:29797086-29797108 TTGTTTCTAATTTGGCTGCCAGG + Intergenic
1094615404 12:32031945-32031967 TGGGTCCTAAATTGGAAGCTGGG + Intergenic
1096334718 12:50744794-50744816 TGGGGTCTAACTGGTCAGCTAGG - Exonic
1099504802 12:83460574-83460596 TGTGTCCTTACTTGGCAGCAAGG + Intergenic
1101674548 12:106906037-106906059 TGGGTTCTTACGTGGCGGCAGGG + Intergenic
1104518549 12:129451280-129451302 AGAGTTCTAACTTGCCAGCTGGG - Intronic
1112974786 13:105304103-105304125 TGGGTTCTTGCATGGCAGCTGGG - Intergenic
1114037207 14:18640835-18640857 GTGGTTCTAAAATGGCAGCCAGG + Intergenic
1114121434 14:19674208-19674230 GTGGTTCTAAAATGGCAGCCAGG - Intergenic
1121067777 14:90984801-90984823 TGGTTTCTGACATGGCAGCATGG - Intronic
1127501412 15:59557253-59557275 TGGCCTCTAACATGGCAGCTTGG + Intergenic
1130889598 15:88122313-88122335 TGGTTGCTAATTTGGCAGTCTGG + Intronic
1132243087 15:100275932-100275954 TGGGTTATGCCTTGGCAGGCAGG + Intronic
1132561314 16:595533-595555 TGGGTTCTCAGATGCCAGCCAGG - Intronic
1133259670 16:4540097-4540119 TTGGCTCTATCTGGGCAGCCAGG + Intergenic
1135172697 16:20200668-20200690 AGGGTTCTATCTTGGCAGTGTGG + Intergenic
1135669197 16:24360725-24360747 AGGGTTCTAACTTGGATGCTTGG - Intronic
1136049503 16:27640397-27640419 TGGGTTGGAACCTGCCAGCCTGG + Intronic
1138529182 16:57625811-57625833 TGGGATCTAACTGGGCAGCAAGG - Intronic
1142034280 16:87854098-87854120 TGGGTTGGAACTGGGCAGGCAGG - Intronic
1142977424 17:3654034-3654056 TGCTTTGTCACTTGGCAGCCAGG + Intronic
1143796988 17:9344893-9344915 TTGGTCATAACTTGGCAGCCAGG + Intronic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1144471469 17:15546027-15546049 TGGGTTCTAACTTAGGAGTTGGG - Intronic
1144925005 17:18798679-18798701 TGGGTTCTAACTTAGGAGTTGGG + Intronic
1144994129 17:19255364-19255386 TGGGTTCTAACCTGGCCTTCTGG + Intronic
1145003020 17:19318768-19318790 GGGGTTCTCACGTGGAAGCCTGG + Intronic
1145285609 17:21503945-21503967 TTGGTTCTAAGTTGGAAGCTGGG + Intergenic
1145391917 17:22461785-22461807 TTGGTTCTAAGTTGGAAGCCGGG - Intergenic
1146492152 17:33291271-33291293 TGGGTTCTGCCTTGGCATCGTGG + Intronic
1147401238 17:40181140-40181162 TGAGTTCTAACTAGGCAGGTGGG - Intronic
1152038263 17:77886770-77886792 TGGGTTCTAACGTGTCTCCCAGG + Intergenic
1152144656 17:78561139-78561161 TGGGTTCTATTTTGGCCTCCTGG - Intronic
1152376490 17:79921320-79921342 TGGCTTCTAACCTGGAACCCGGG + Intergenic
1157090269 18:44628449-44628471 TAGATTCTAACTTGGCAGTTTGG - Intergenic
1157290565 18:46406655-46406677 TGTGGTCAAACTTGTCAGCCAGG - Intronic
1157725662 18:49961769-49961791 TGAGTGCTGACTTGTCAGCCTGG - Intronic
1158438804 18:57455183-57455205 TAGGTTCTGACTTGGCTCCCTGG + Intronic
1158546042 18:58397979-58398001 TGGCTTCTCACATGCCAGCCAGG - Intronic
1159650049 18:70967641-70967663 AGGTTTCTAAGTTGGCATCCAGG + Intergenic
1160142489 18:76338124-76338146 TGGATTCTAACTTTGCACCAGGG + Intergenic
1160770261 19:827948-827970 TGAGTTCTGCCCTGGCAGCCGGG - Intronic
1162124675 19:8493130-8493152 AGGGCTCTGACTTGGGAGCCTGG - Intronic
1162451404 19:10757315-10757337 TGGGTTCTAGCCCGTCAGCCGGG - Intronic
1162592838 19:11604334-11604356 TGGGGGCTGAATTGGCAGCCAGG + Intronic
1163698447 19:18775490-18775512 GGGGTTCGTGCTTGGCAGCCTGG + Intronic
1164014687 19:21242934-21242956 TGGGTTGTAACTTGGTCACCAGG - Intronic
1164571495 19:29377972-29377994 TGGGTTCCATCATGGCAGCCAGG - Intergenic
1164951879 19:32344296-32344318 AGAATTCTAACTTTGCAGCCGGG + Intergenic
1166721605 19:45000248-45000270 TAGGTTCTAAGTTGGATGCCAGG - Intergenic
932845654 2:75133595-75133617 TGGGTTTAAACTTGGCAGTCTGG + Intronic
935546487 2:104405223-104405245 AGGATTCAAACTGGGCAGCCTGG + Intergenic
937454237 2:122027588-122027610 TAGGTTCTAACTGTGCAGGCTGG + Intergenic
939282638 2:140084507-140084529 TGCATTCTAAATTGGCAACCTGG + Intergenic
940084806 2:149847201-149847223 TGGGTTCCTCCTTGGCAGCGTGG - Intergenic
945734392 2:213581055-213581077 TGGGTTTTAACTTGTAAGACTGG - Intronic
1169570203 20:6897947-6897969 TGGGTTCTAGGCTGGCAGCTGGG + Intergenic
1170812858 20:19688078-19688100 TGCTTTCTATCTTGGCAGCTGGG - Intronic
1170828371 20:19817348-19817370 TGTGTCCTCACTTGGCAGACGGG + Intergenic
1171508537 20:25660144-25660166 TTGGTTCTGAGTTGGAAGCCAGG + Intergenic
1173105352 20:40128453-40128475 TGGGGTAAAACTTGGCAGCAAGG + Intergenic
1173125944 20:40336205-40336227 AGGGTTCAATCTTGGCAGCTGGG - Intergenic
1174876437 20:54231386-54231408 TGGGTTATGAATTGGCAGTCTGG - Intergenic
1175537681 20:59726243-59726265 TGGGTTGTCACTTGGCATACTGG + Intronic
1178202722 21:30425959-30425981 TGAGTTTTAACGTGGCATCCTGG + Exonic
1178436770 21:32567042-32567064 CGGGCTCTTACTTGGCAGCATGG + Intergenic
1180461330 22:15567883-15567905 GTGGTTCTAAAATGGCAGCCAGG + Intergenic
1182191713 22:28467959-28467981 CGGGTTCTCACTTTGCTGCCCGG + Intronic
1182209444 22:28662382-28662404 TGGATTCTAATTTAGCAGCCTGG - Intronic
1183000596 22:34855566-34855588 TGGCTTCTGCCTTGGCAGGCAGG - Intergenic
1183939147 22:41282995-41283017 TGGGTTCTAACTTATAACCCTGG + Intronic
954354739 3:50075482-50075504 TGGGTTATAGCTTGGCAGGCTGG + Intronic
955488637 3:59460487-59460509 TGGGTTCAAACCTACCAGCCTGG - Intergenic
955951292 3:64244929-64244951 TGGATCAAAACTTGGCAGCCTGG - Intronic
956678671 3:71757886-71757908 TGCGTTCAAACTTGGCTACCTGG + Intergenic
956757670 3:72405287-72405309 TGGGTTTTATCTTGGCTTCCTGG - Intronic
956876944 3:73473333-73473355 TGGGGTCTCAGTTGGCTGCCAGG - Intronic
957567344 3:81902143-81902165 TGGGTGCTAAATGGGGAGCCAGG - Intergenic
959647097 3:108715911-108715933 TGAGTTCAAACTTTGCAGACAGG + Intergenic
968284467 3:197499971-197499993 TGGATTCCATCTGGGCAGCCAGG - Intergenic
970672877 4:18416405-18416427 TTGGTTCTAATTTGGAAGCAGGG - Intergenic
976492922 4:85693136-85693158 TAGGCTCAAACTTGGCAGCTGGG + Intronic
977725480 4:100291735-100291757 TGGGTTCTAACTTCACAGCTTGG + Intergenic
980371815 4:131883514-131883536 TGGGTCCTGAGTTGGCAGCGGGG - Intergenic
981367409 4:143919106-143919128 TGGGTCAGAGCTTGGCAGCCAGG + Intergenic
981377193 4:144029340-144029362 TGGGTCAGAGCTTGGCAGCCAGG + Intergenic
981743673 4:148030756-148030778 TGGGTTGCATCTTTGCAGCCTGG + Intronic
984435575 4:179706162-179706184 TGGGTTTTTACTTGGGAGCCTGG + Intergenic
987274579 5:16348424-16348446 TGGGGTCTCACTTGTCATCCAGG - Intergenic
987287075 5:16467070-16467092 TTGGTTTTCTCTTGGCAGCCTGG - Intergenic
992089739 5:73306385-73306407 TGGCTTCTCTCTTGGCTGCCAGG - Intergenic
993592738 5:89814816-89814838 TAGGATCTAAAATGGCAGCCTGG + Intergenic
996909379 5:128637736-128637758 TGACTTCTGACTTGGTAGCCAGG + Intronic
998376632 5:141695201-141695223 TGGGTGGTTAGTTGGCAGCCAGG - Intergenic
1003352505 6:5331395-5331417 AGGGGTATAACTTGGCAGGCTGG - Intronic
1006336615 6:33424382-33424404 TGGGTTCTGATTTGGGAGCTGGG + Intronic
1008298388 6:49805346-49805368 TGGGTCTTAACTTGGGAGCAGGG - Intergenic
1013554139 6:111239267-111239289 TGGGGTCTTACTATGCAGCCAGG + Intergenic
1014261572 6:119224426-119224448 TGGTTTTTAACCTGGCACCCTGG - Intronic
1016710575 6:147166602-147166624 TTGGTCCTAAGTTGGAAGCCAGG - Intergenic
1018992011 6:168681432-168681454 TGGGTTATAGGTTGGCAGCTTGG - Intergenic
1018992017 6:168681471-168681493 TGGGTTATAGGTTGGCAGCTTGG - Intergenic
1022416830 7:30185722-30185744 TGGGTTCTAACATGGTAGAAGGG + Intergenic
1023899878 7:44467487-44467509 TGGGTTCTAACTTGGCAGCCTGG - Intronic
1024966349 7:55025402-55025424 AGGCTTCTCACTTGGAAGCCTGG + Intronic
1027057477 7:75059953-75059975 TGGGTTTTACCGTGTCAGCCAGG + Intronic
1032524238 7:132567529-132567551 TGGGTTCTTACTCTGCAGCAGGG - Intronic
1036422910 8:8614426-8614448 TGGGTCCTAAATTGGAAGCAGGG + Intergenic
1039713511 8:40083710-40083732 TGGATTCTAACTTTGCATCCAGG + Intergenic
1041918283 8:63157761-63157783 TGGGTTCTTGTTTGGCATCCAGG + Intergenic
1042806417 8:72775377-72775399 AGGGCTCAAAATTGGCAGCCTGG - Intronic
1043094640 8:75951230-75951252 AGGTTTCTAACTTGGGATCCTGG + Intergenic
1043464603 8:80492502-80492524 TGGGGTCTCACTTGTCACCCAGG + Intronic
1045019755 8:98031763-98031785 TGGGATCTAACTGGTGAGCCGGG - Intronic
1047020944 8:120774575-120774597 AGGTTTCTAGCTTGGGAGCCTGG + Intronic
1048905533 8:139084630-139084652 TGGGTTCTAACTTGGTTTCTAGG + Intergenic
1048934491 8:139343778-139343800 TGGGTTCTAACTTCACAGGGAGG + Intergenic
1049340458 8:142109584-142109606 TGGGTGGTGACTTGGCATCCAGG - Intergenic
1052066718 9:24031167-24031189 TGGGATCTAAGTTAGCATCCAGG + Intergenic
1052610543 9:30767860-30767882 TAGGTTCGAACATGTCAGCCAGG - Intergenic
1053636517 9:40011061-40011083 TGGGTCCTGAGTTGGCAGCGGGG - Intergenic
1053769476 9:41453587-41453609 TGGGTCCTGAGTTGGCAGCGGGG + Intergenic
1054548143 9:66365066-66365088 TGGGTCCTGAGTTGGCAGCGGGG + Intergenic
1055550579 9:77428834-77428856 TGGTTTCTAAGAAGGCAGCCGGG - Intronic
1058560338 9:106221772-106221794 TGGGTTCTCACTTGGCAGAAGGG - Intergenic
1058814236 9:108668769-108668791 TGGGTCCTATGCTGGCAGCCTGG - Intergenic
1061514169 9:131079022-131079044 TGGGTTCTTGGCTGGCAGCCAGG + Intronic
1189816611 X:44830474-44830496 TGGTTTCTGACTTGGGCGCCTGG - Intergenic
1192022716 X:67410923-67410945 TGGGTTTTACCTTGTTAGCCAGG - Intergenic
1194634296 X:96324887-96324909 TTGGCTCTACCTTGGCAGTCCGG + Intergenic
1195962287 X:110398177-110398199 AGGGTTTCAGCTTGGCAGCCAGG + Intronic