ID: 1023901525

View in Genome Browser
Species Human (GRCh38)
Location 7:44484669-44484691
Sequence CTCTAAACACAGATAAAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023901522_1023901525 22 Left 1023901522 7:44484624-44484646 CCTGCAGAGAGAAAAACACAAAC 0: 1
1: 0
2: 3
3: 48
4: 572
Right 1023901525 7:44484669-44484691 CTCTAAACACAGATAAAGTTAGG 0: 1
1: 0
2: 0
3: 25
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023901525 Original CRISPR CTCTAAACACAGATAAAGTT AGG Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
901874609 1:12160210-12160232 ATCTAAACAAAGATAATGTAGGG + Intergenic
904019928 1:27456020-27456042 CTCTAAACAGTGAAAAGGTTAGG + Intronic
904243566 1:29168422-29168444 CTCTAACATCAGATAAAGTCAGG + Intronic
906322147 1:44823448-44823470 CTCTGAAGACAGATACAGCTCGG - Intronic
908068395 1:60432721-60432743 CTCTAAATACAGTTGCAGTTTGG - Intergenic
910649620 1:89551517-89551539 CTTAAAACACTTATAAAGTTAGG - Intronic
911092485 1:94029077-94029099 ATATAAACACAGATAATGTTTGG - Intronic
913486972 1:119340591-119340613 CACAAAACACAGATAAAGGTAGG - Intergenic
914294304 1:146305400-146305422 CTCTAAAAAGAGCTAATGTTTGG - Intergenic
914555348 1:148756183-148756205 CTCTAAAAAGAGCTAATGTTTGG - Intergenic
917257820 1:173134743-173134765 CCCAAAACACAGAAGAAGTTTGG - Intergenic
917382175 1:174423891-174423913 TTCTAAAAACAGAGAAAGTTTGG - Intronic
919690672 1:200525987-200526009 TTCTAAGCACAGATAAAATAGGG + Intergenic
921140726 1:212304093-212304115 CTCTAAACACCCTTAAATTTTGG + Intronic
922501981 1:226103980-226104002 ATCTAAACAGAGAAAAAGTATGG - Intergenic
923956412 1:239026914-239026936 TGCTGAACACAGGTAAAGTTCGG + Intergenic
924105553 1:240645620-240645642 CTCTAGAGGCAGATAAACTTAGG + Intergenic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1067345170 10:45433057-45433079 CTCTAACTACAGGTGAAGTTAGG - Intronic
1067663984 10:48257578-48257600 CTCTAAAAAAAGGTAAAGGTTGG - Intronic
1068724988 10:60290817-60290839 CTCTATTTAAAGATAAAGTTGGG - Intronic
1080724847 11:34886704-34886726 ATCTAAACATAGAAAAGGTTTGG - Intronic
1081333634 11:41835721-41835743 CTCTAGATACAGACAAACTTAGG + Intergenic
1083866457 11:65456402-65456424 CTTTTGACACAGACAAAGTTTGG - Intergenic
1083968682 11:66059004-66059026 CTCTTAAAGAAGATAAAGTTGGG - Exonic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1086156029 11:83666867-83666889 CTCTAAATACAGAGAAAGAATGG + Intronic
1087202595 11:95360927-95360949 GTCTAACCACAAATAAAGCTGGG - Intergenic
1087750914 11:102006063-102006085 TTCTAAAGACAGATAGACTTTGG - Intergenic
1088944677 11:114497485-114497507 ATCTAAACATAGAAAAAGTACGG - Intergenic
1089726689 11:120486815-120486837 CTAAAAACACAGATCAATTTAGG - Exonic
1090136337 11:124203345-124203367 CTCTTAATACAGGTAAAATTGGG + Intergenic
1092601875 12:10075572-10075594 CTATAAAGACAGCAAAAGTTGGG - Exonic
1092956014 12:13550834-13550856 CTCAAAACACAAACAATGTTAGG - Exonic
1093583940 12:20815144-20815166 CTCAAAAAGCAGATAAAGTTTGG - Intronic
1094314004 12:29117283-29117305 GTCTAAACATAGAAAAAGTGCGG - Intergenic
1097503171 12:60432138-60432160 CTTAAAACACTGATACAGTTTGG + Intergenic
1098619923 12:72582906-72582928 CTGTAAAAACAGAAAAAGATAGG - Intronic
1099899795 12:88694127-88694149 ATCTAAACATAGACAAGGTTTGG - Intergenic
1099930927 12:89073598-89073620 CTCTAATCACAGATTAGGTCTGG + Intergenic
1101359971 12:104017194-104017216 CTTTAAACACATATACAATTAGG - Intronic
1104337885 12:127917751-127917773 ATCTGAACAAAGATAATGTTGGG + Intergenic
1105513051 13:21067084-21067106 CTCAAAACACAGACAAAGCCTGG - Intergenic
1106142982 13:27026497-27026519 CTCTAAAAAAAGAAAAAGTGAGG + Intergenic
1107981844 13:45741469-45741491 CTTTAAACAGACATAAAGTAAGG + Intergenic
1109449997 13:62500386-62500408 GTTTAAACACAGTTAAAATTTGG + Intergenic
1110063827 13:71075395-71075417 CACTAAAGAAAGAGAAAGTTTGG - Intergenic
1110170811 13:72498239-72498261 CTATAAACATACATAAACTTAGG + Intergenic
1111117097 13:83793485-83793507 CTCTAAAAGCAGATAATTTTGGG - Intergenic
1113862730 13:113500272-113500294 CTCAAATCACAGATAATGTACGG - Intronic
1113980925 13:114274855-114274877 CTTTAAAAACAGAAAAAGTTTGG - Intergenic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1118079638 14:62343596-62343618 CTCTAAACTAAGACAGAGTTTGG - Intergenic
1122962481 14:105102233-105102255 CCATAAACAACGATAAAGTTGGG + Intergenic
1124448313 15:29760307-29760329 CTCTAAAGAAAGATAAACTCAGG + Intronic
1125099676 15:35897417-35897439 ATCTAATCAAAAATAAAGTTGGG - Intergenic
1125885891 15:43229242-43229264 CTGTGAACATAGATAATGTTAGG - Intergenic
1125991247 15:44110605-44110627 CTCTTAACACAGAAAAAGTGTGG + Intronic
1127359889 15:58236187-58236209 ATTTAAACACTGATATAGTTTGG + Intronic
1128210454 15:65896655-65896677 CTATGAACACAGATAAACTGAGG - Exonic
1128389625 15:67174284-67174306 CTGGAAACACCGATGAAGTTTGG + Intronic
1128426988 15:67551968-67551990 TTCAATACACACATAAAGTTGGG - Intronic
1130241675 15:82199154-82199176 GTCCAAAAACAGATAAAATTAGG + Intronic
1131024034 15:89124642-89124664 CTCTTAAAACAGATAAAATCAGG - Intronic
1131384415 15:91991375-91991397 CTGTTAACACATATAAAATTGGG - Intronic
1131953981 15:97711463-97711485 CTATAAATACAGACAAGGTTTGG + Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135993956 16:27234503-27234525 TTCCAAACTCAGATAAATTTGGG + Intronic
1139294788 16:65891015-65891037 CTATAAACAGAAATAAAATTAGG - Intergenic
1141047821 16:80732857-80732879 CTCTAAACAAGGGTCAAGTTGGG + Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1147473623 17:40687974-40687996 TTCTACACACACATAAAGTAGGG + Intergenic
1147814593 17:43199798-43199820 CTATAAAAAGAGAAAAAGTTAGG - Intronic
1150043862 17:61891966-61891988 CTCTAAATACAGATATGGTAGGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151045846 17:70918649-70918671 ATTTAAACACAGATAGAGATGGG + Intergenic
1152005727 17:77679266-77679288 ATCTAAACATAGAAAAGGTTGGG + Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1159820631 18:73138232-73138254 ATATAAACACAGGCAAAGTTAGG + Intergenic
1160821299 19:1059562-1059584 CTCTAAAAAAAGATAAAATAGGG - Intronic
1162613558 19:11776387-11776409 TTCCAAAAACAGATAAAGTATGG - Intronic
1162634046 19:11952648-11952670 CTCCACACACAGATAGGGTTTGG - Intronic
1163680915 19:18682006-18682028 CTCAAAACAAAGATAAAGTAGGG + Intergenic
1164796355 19:31036068-31036090 CTCTAATGACTAATAAAGTTGGG - Intergenic
1165114383 19:33520441-33520463 CTCTGAGCTCAGATAAAGTGTGG - Intronic
928221943 2:29410680-29410702 ATCTAAACATAGAAAAAGTATGG + Intronic
928464142 2:31504531-31504553 CTTGGTACACAGATAAAGTTGGG + Intergenic
928477281 2:31641729-31641751 CAATGAACACAGAAAAAGTTTGG + Intergenic
928982051 2:37146079-37146101 ATCTAAACACAGAAAAAGTACGG - Intronic
929620488 2:43349314-43349336 CTCTAAACACAGAGAGACTCAGG + Intronic
929871894 2:45766115-45766137 CCATAAACACAGATAAACTTGGG - Intronic
932150238 2:69364326-69364348 TTTTAATAACAGATAAAGTTAGG + Intronic
934096151 2:88606909-88606931 GTCTAAACTTAGATAAGGTTTGG - Intronic
936017360 2:108969951-108969973 CTTTAAACACAGTTAAAAGTGGG + Intronic
936760666 2:115777031-115777053 CTATAAACACAGATCAAGGCAGG - Intronic
938189423 2:129262259-129262281 CACTAAACACATATAAAAATAGG - Intergenic
939114769 2:138048109-138048131 CTATATACACAGATAAGGTCTGG - Intergenic
939209572 2:139156483-139156505 CTCTAAAGACATTTTAAGTTAGG - Intergenic
939227816 2:139385852-139385874 CTATAAACATAGAGAAAATTTGG - Intergenic
939255735 2:139742977-139742999 CTCTATACATATATTAAGTTTGG + Intergenic
948253311 2:236548410-236548432 CCCTAAACCCACATAAAGTCTGG + Intergenic
1168814402 20:727046-727068 CTCTACCCACAGATGAACTTGGG + Intergenic
1169348123 20:4845645-4845667 GTCTACACACAAATAAATTTGGG - Intergenic
1174324443 20:49768077-49768099 CTCCAAACACTGAGAAACTTGGG - Intergenic
1174370854 20:50086318-50086340 CACTAAACACAGAAAAAGGAGGG + Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1176973611 21:15292477-15292499 CTCTGAAATCAGTTAAAGTTTGG + Intergenic
1177691398 21:24512985-24513007 CTCTAATCAATGATATAGTTTGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
949639266 3:6016669-6016691 CACTAAACACCAATAAAATTTGG - Intergenic
954816239 3:53283008-53283030 ATCTAAACACAGAAAAGGTCGGG + Intergenic
956431822 3:69194201-69194223 CTTTAGAGACAGATAAATTTGGG + Intronic
956783869 3:72626033-72626055 ATCTAAACACAGAAAAGGTACGG + Intergenic
958652459 3:96954634-96954656 CTCTAAAGAAATATAAAGTGAGG - Intronic
963808284 3:149748537-149748559 CACTAGACACAGTTAAATTTTGG - Intronic
965440452 3:168706648-168706670 CTCAAAATACAGAGGAAGTTTGG + Intergenic
966591793 3:181692254-181692276 CCTTAAACACAGATAGAATTGGG + Intergenic
966696558 3:182794770-182794792 CTCATCACACAGATAAGGTTAGG - Intronic
969202753 4:5618706-5618728 CTCTTAACACAGAGAAAGCCTGG + Intronic
970711473 4:18868611-18868633 CTTTATACACTGATAAACTTAGG + Intergenic
970746300 4:19300030-19300052 ACACAAACACAGATAAAGTTGGG + Intergenic
971158928 4:24113484-24113506 CTCTATGCACAGAGAAAGTGGGG - Intergenic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
972120125 4:35691495-35691517 CTCTAAAAGTAGATAAAGCTAGG + Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974110646 4:57521415-57521437 GTATAAATACTGATAAAGTTTGG - Intergenic
976581711 4:86744613-86744635 ATCTAAACACAGAAAAGGTGTGG - Intronic
977284035 4:95079668-95079690 ACATAAACACACATAAAGTTAGG + Intronic
978851585 4:113343667-113343689 CTCTAAACAGAGACCAAGTTAGG + Intronic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
983800401 4:171921868-171921890 CTCTAAGCAAATATAGAGTTTGG - Intronic
985419320 4:189767924-189767946 TTCTAAACACAGCTAAACGTTGG - Intergenic
986619306 5:9654686-9654708 CACTAGAGAAAGATAAAGTTAGG + Intronic
987040099 5:14054393-14054415 ATCTAAACACAGAAAAGGTACGG - Intergenic
987579021 5:19764478-19764500 ATATAAACACATATAAAGTTAGG + Intronic
988005311 5:25402867-25402889 CTCTAAAAACAGCTCAAGCTAGG - Intergenic
988349359 5:30081868-30081890 CTCTAAACAAATATAAACTCCGG - Intergenic
990392848 5:55344947-55344969 CTCTTACCACAGATCATGTTTGG + Intronic
992120854 5:73590595-73590617 CTCAAAACACACACAAACTTAGG - Intergenic
993959621 5:94280890-94280912 CTCAAAACACTGATACAGTTTGG - Intronic
994524925 5:100893979-100894001 TTATAAACACAGATATACTTTGG - Intronic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995834927 5:116390709-116390731 ATCTAAACACAGAAAAGGTATGG - Intronic
996294542 5:121896105-121896127 CTCAAAACACAGATAAGGGAAGG + Intergenic
999549008 5:152663125-152663147 ATCTAAACACAGACAAGGTATGG - Intergenic
1000815155 5:165912051-165912073 CCCTAAAAACAGAGATAGTTTGG + Intergenic
1002305674 5:178281196-178281218 ATCTAAAAACAGATGAATTTGGG + Intronic
1004035471 6:11918923-11918945 CCCTAAACACAGAGCAGGTTTGG + Intergenic
1004381452 6:15136119-15136141 CTACAAACACAGATAAAATATGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1004981820 6:21032627-21032649 ATCTAAACACAGAAAAGGTATGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1010249732 6:73695389-73695411 CTCTGAACACAGTTAGGGTTGGG - Intergenic
1015069700 6:129076555-129076577 CTCCAAACACAGATTTAATTTGG + Intronic
1015377006 6:132521999-132522021 CTTTAAAAACATATAAAGTAAGG - Intergenic
1015694610 6:135966231-135966253 CTCTAAAGACAAATCAAGTACGG - Intronic
1015721208 6:136244334-136244356 GTCTAAACATAGAAAAAGTATGG - Intronic
1018072824 6:160180843-160180865 CTCAAGTAACAGATAAAGTTAGG + Intronic
1018550765 6:164996101-164996123 CAGTAAACACACATAAAGTAAGG - Intergenic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1020545795 7:9528602-9528624 CTCTAAGCACAGTGAAACTTGGG - Intergenic
1020822773 7:12990971-12990993 TGCTAAACACAGATGAATTTTGG + Intergenic
1020836751 7:13162853-13162875 ATCTTGACACAGACAAAGTTAGG - Intergenic
1022222157 7:28324055-28324077 CTGTAAACACAGAGAAGCTTTGG + Intronic
1022488408 7:30798205-30798227 ATCTAAACACATCTAAATTTAGG + Intronic
1023248965 7:38237268-38237290 TTCTAAAGACAGATGAACTTAGG + Intergenic
1023901525 7:44484669-44484691 CTCTAAACACAGATAAAGTTAGG + Intronic
1024019472 7:45352557-45352579 ATCTAAACAGAGAAAAAGTATGG + Intergenic
1027682142 7:81233908-81233930 CTCTAAAAGCATATAAAGGTTGG - Intergenic
1027878631 7:83803015-83803037 CTATAAATTCAGATAAAGTTTGG + Intergenic
1028281045 7:88928199-88928221 CTCTAAAGAGAAATAAAGTCAGG - Intronic
1028798195 7:94929396-94929418 TTCGAAACTCAGATAGAGTTTGG - Intronic
1030150231 7:106397164-106397186 TTCTCATCACAGATAAAGTGAGG - Intergenic
1030771430 7:113480012-113480034 CTGTACACACAGAAAAAGTTAGG + Intergenic
1030782280 7:113616361-113616383 CTCCAAATACAGATAACATTAGG - Intergenic
1031024793 7:116668662-116668684 TTCTGAGCACAGATAAAATTTGG - Intergenic
1031447969 7:121878070-121878092 CTTTAAACACAGAGAAAAATTGG - Intronic
1032556166 7:132837151-132837173 CTATAAAAACAGCTAAATTTCGG - Intronic
1032986598 7:137344129-137344151 CTCTAAACACAGAGACAGTAAGG + Intergenic
1033042909 7:137934601-137934623 CTCTAAAGCTAGATAAAGATAGG + Intronic
1034091950 7:148371868-148371890 CACTAAACATAGACAAAGTATGG + Intronic
1035082903 7:156232600-156232622 CTCAAAACAAAGATAAACTTTGG + Intergenic
1036000598 8:4599071-4599093 CTCTACACAAAGACAATGTTAGG + Intronic
1036545266 8:9762600-9762622 CTGTAACAACAGATAAAATTGGG + Intronic
1038033666 8:23667121-23667143 CTCTAATTACAAATAATGTTTGG + Intergenic
1041001297 8:53456924-53456946 CTTTAAACACAGCTAAATTCTGG + Intergenic
1041032563 8:53753012-53753034 CACTGAACACCCATAAAGTTTGG + Intronic
1041163930 8:55072640-55072662 CTCTGAGGACAGATAAAGCTGGG - Intergenic
1041503567 8:58567851-58567873 ATCTAAACACAGAAAAGGTATGG + Intronic
1042437490 8:68784185-68784207 CTTTAAACACAGGGAAAGCTTGG - Intronic
1042448459 8:68917164-68917186 CACTGAACACAGCTAGAGTTGGG + Intergenic
1044159324 8:88893584-88893606 CTCAAGACAAAGATAAACTTAGG + Intergenic
1044309184 8:90673873-90673895 CCCCAAACTCAGAAAAAGTTGGG - Intronic
1045079422 8:98608528-98608550 ATTTTAACACAGATAAAATTTGG + Intronic
1045619825 8:103962863-103962885 TTCTAAACCCAGCTAAATTTTGG + Intronic
1046087301 8:109454345-109454367 ACCTAAACAAAGATAAACTTAGG - Intronic
1047799663 8:128295483-128295505 ACCTAAACGCACATAAAGTTGGG - Intergenic
1048363602 8:133718927-133718949 CTCTTAACACACATAAAGTAGGG + Intergenic
1050575562 9:6991493-6991515 CTCTAAACACAGAAAAAATAAGG - Intronic
1051532557 9:18120948-18120970 CTCTACACAGAAATACAGTTTGG + Intergenic
1054703661 9:68439775-68439797 CTCTGACCAGAAATAAAGTTGGG - Intronic
1055228603 9:74032030-74032052 CTTAAAATACAGAAAAAGTTGGG + Intergenic
1056083895 9:83125748-83125770 CTGCACACACAGATAAGGTTTGG + Intergenic
1059008675 9:110432858-110432880 CACTAGACGCTGATAAAGTTTGG + Intronic
1060678506 9:125539107-125539129 TTCTAAACAGATATAGAGTTAGG + Intronic
1060774981 9:126366473-126366495 AACTAAACACAGTTAAAGTGTGG - Intronic
1186037687 X:5442606-5442628 CTCTAAAAAAATAAAAAGTTAGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186991556 X:15074718-15074740 CTCTAAATACTGATAATTTTTGG - Intergenic
1188378780 X:29466162-29466184 CTCTAAACACAGTATAATTTAGG + Intronic
1189377518 X:40477084-40477106 CTGTAAACACAGATACACTAGGG - Intergenic
1198082886 X:133255619-133255641 CTATAAACAGAAATATAGTTTGG + Intergenic
1198401766 X:136275554-136275576 CTCTGAACACAGAGAAAGCAGGG - Intergenic
1201633628 Y:16097596-16097618 CTCTAAAAAAATAAAAAGTTAGG + Intergenic