ID: 1023902094

View in Genome Browser
Species Human (GRCh38)
Location 7:44489775-44489797
Sequence TTTACACTCTTAGTTGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 53}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023902094_1023902095 -6 Left 1023902094 7:44489775-44489797 CCTGCGGCAACTAAGAGTGTAAA 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1023902095 7:44489792-44489814 TGTAAACTACATTCAGCAAAAGG 0: 1
1: 0
2: 3
3: 19
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023902094 Original CRISPR TTTACACTCTTAGTTGCCGC AGG (reversed) Intronic
910206034 1:84749590-84749612 TTTAGAATCTTACTGGCCGCAGG + Intergenic
912244324 1:107944924-107944946 ATTACACTCTTAACTTCCGCAGG - Intronic
913132385 1:115852989-115853011 TTTAAAGTCTTAGTTACAGCAGG + Intergenic
917260442 1:173161278-173161300 TTTACACTCCTGGTTTCCTCTGG - Intergenic
919106673 1:193161229-193161251 TTTAAACTCTTACTTGCTTCTGG + Intronic
921153434 1:212419436-212419458 TTGATACTCTTGGTTGCCTCAGG + Intergenic
924222978 1:241897349-241897371 TTTAAAATCTTAATTGCCGCTGG - Intergenic
924250935 1:242132539-242132561 TTTATATTCTGAGTTGCTGCAGG + Intronic
1069317895 10:67130552-67130574 TTTACACTCTTATCTGTCACAGG - Intronic
1078240377 11:9525843-9525865 TTTAGAATCTTAGGTGCAGCCGG + Intronic
1089484903 11:118837748-118837770 TTTACACTAGTAGTTACCGAGGG + Intergenic
1089590674 11:119538582-119538604 TTTCCACTCTTAGTTCCCACAGG + Intergenic
1093180601 12:15962800-15962822 TTAACTCTATTAGTGGCCGCTGG + Exonic
1108891800 13:55270665-55270687 TTTACACACTTAGTAGTAGCAGG - Intergenic
1112952071 13:105011259-105011281 TTTACAGTCTTGGCTGCCTCTGG + Intergenic
1117061644 14:51970078-51970100 TTTACACTTTCACTTGCTGCAGG + Intronic
1117114548 14:52496241-52496263 TATACACTCCTAGTTGAAGCGGG + Intronic
1122504039 14:102220279-102220301 TTTACATACTTAGTGGCTGCAGG - Intronic
1123981945 15:25612700-25612722 TTTACATTCACAATTGCCGCTGG - Intergenic
1142812869 17:2403713-2403735 TTTACACTCTTCTTTGTCACTGG + Intergenic
1157107470 18:44788137-44788159 TGTAGAATCTTAGTTTCCGCTGG + Intronic
926901442 2:17754803-17754825 TTTACACTCTAGGTTACCGTGGG - Intronic
927033987 2:19152563-19152585 TTTACCCTCTTCCTTGCCTCTGG + Intergenic
928607659 2:32958473-32958495 ATTTCACTCTTAGTTGGCTCTGG + Intronic
930762533 2:55050913-55050935 TTTCCACTCTCAGTTCCCCCAGG - Intronic
932788712 2:74633086-74633108 TTCACACTCTTACTTCCAGCTGG + Intronic
936455771 2:112672872-112672894 TTTACATTCTAAGTTTCCACTGG + Intergenic
943502119 2:188705330-188705352 TTACCACTCTCAGTTGCCCCAGG + Intergenic
1169576355 20:6966322-6966344 TTTACACTCTTAGGTACTGGGGG - Intergenic
1172376292 20:34443680-34443702 TTTACGTTGTTAGTTGCTGCCGG + Intronic
1175575277 20:60056294-60056316 CTTAGACTCTTAATTGCCTCTGG + Intronic
1176983044 21:15405087-15405109 TTTGCACTCTGAGTTGCCATGGG - Intergenic
952116367 3:30186503-30186525 TTCCCCCTCTTAGTTGCCTCTGG + Intergenic
952803425 3:37320407-37320429 TTTTCACTCTTAGTTGCATCTGG + Intronic
954007617 3:47604518-47604540 TTTAGTCTCTGAGTTGCCACAGG - Intronic
957120964 3:76091682-76091704 TTTACACTCTCAATTACCGAAGG - Intronic
965610828 3:170542304-170542326 TTAACACAATTAGTTGCCTCTGG - Intronic
966470521 3:180283771-180283793 TTTACTCTGCTAGTTGCAGCAGG - Intergenic
967051527 3:185789139-185789161 TTTACAGTCTTTGTTGATGCTGG - Intronic
984558053 4:181239011-181239033 TTTACTCTCTCAGTTTCCGTGGG - Intergenic
994629139 5:102260963-102260985 TTTACATTGTTATTTGCAGCAGG - Intronic
995919279 5:117291804-117291826 TTTACATTCTGAGTTGTTGCTGG - Intergenic
1005228519 6:23671705-23671727 TTTGCACTCTTAGTACCTGCAGG + Intergenic
1015058374 6:128931840-128931862 TTTAAACTCTTACTTTCCACGGG + Intronic
1019880114 7:3851960-3851982 TTTACACTATTTAATGCCGCTGG + Intronic
1021841483 7:24724889-24724911 TTTACACTCTGAGTTCACACTGG + Intronic
1023902094 7:44489775-44489797 TTTACACTCTTAGTTGCCGCAGG - Intronic
1030017128 7:105234208-105234230 TTTATACTAGTAGTTGCCACTGG + Intronic
1032985541 7:137333117-137333139 TTCCCACTCTTAGTTCCCCCAGG + Intronic
1033064773 7:138144267-138144289 TTTGAACTCTTAGTTGCCCAAGG - Intergenic
1036078166 8:5523879-5523901 TTTAGTCACTTAGTAGCCGCCGG - Intergenic
1039223137 8:35357545-35357567 TTTACCCTCTTATTTCCCCCAGG + Intronic
1056405760 9:86273269-86273291 TGTACATTGTTAGTTGCCGATGG - Intronic
1057218876 9:93244948-93244970 TCTACACTCAGGGTTGCCGCTGG - Intronic
1186564988 X:10652822-10652844 TTTGCACTCTTAGTTTCTTCAGG + Intronic
1191015356 X:55804159-55804181 TTTACATTCTCAGTTGGAGCGGG + Intergenic
1195926285 X:110029012-110029034 TCCACACTCTAAGTTGCCACGGG - Intronic