ID: 1023905277

View in Genome Browser
Species Human (GRCh38)
Location 7:44517320-44517342
Sequence GTTTTTCAGGGGCTTGTGAT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023905271_1023905277 5 Left 1023905271 7:44517292-44517314 CCCGCAGAGCTTCTGTGTAATCC 0: 1
1: 0
2: 0
3: 9
4: 140
Right 1023905277 7:44517320-44517342 GTTTTTCAGGGGCTTGTGATAGG 0: 1
1: 0
2: 1
3: 19
4: 188
1023905270_1023905277 20 Left 1023905270 7:44517277-44517299 CCAGCTCTCGAGCTGCCCGCAGA 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1023905277 7:44517320-44517342 GTTTTTCAGGGGCTTGTGATAGG 0: 1
1: 0
2: 1
3: 19
4: 188
1023905272_1023905277 4 Left 1023905272 7:44517293-44517315 CCGCAGAGCTTCTGTGTAATCCT 0: 1
1: 0
2: 1
3: 18
4: 185
Right 1023905277 7:44517320-44517342 GTTTTTCAGGGGCTTGTGATAGG 0: 1
1: 0
2: 1
3: 19
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023905277 Original CRISPR GTTTTTCAGGGGCTTGTGAT AGG Exonic
900468911 1:2841398-2841420 TTTTTGCAGGTGCTTTTGATCGG + Intergenic
901000220 1:6145357-6145379 GTTTTTGAGGGGCTTAGGATCGG - Intronic
904367935 1:30028580-30028602 GTCTGTCATGGGCATGTGATGGG - Intergenic
906816375 1:48884152-48884174 GTTTTTCAGGCACCTGTTATTGG + Intronic
906823837 1:48957657-48957679 GTTTTTTAGGGGCTGGGGAGTGG - Intronic
907915283 1:58862707-58862729 GTTTTTCAAGTGCTTCTTATGGG - Intergenic
909864367 1:80648686-80648708 ATATTGCAGGAGCTTGTGATGGG + Intergenic
910509064 1:87983564-87983586 GTTTCAGAGGGGCTTGTGATCGG - Intergenic
910559850 1:88578622-88578644 GGCTTACAGGTGCTTGTGATGGG + Intergenic
910651690 1:89575067-89575089 GTTTTTGGGGGGCTTGGGAAAGG + Intronic
912721183 1:112021603-112021625 GTGTTGCAGGGGCTTGTGCTGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915996043 1:160564738-160564760 GTTTTTCAGGGACTGGGGAAGGG + Intronic
917262879 1:173188895-173188917 GTTTTTGAGGGGGTAGAGATGGG + Intronic
919090463 1:192972878-192972900 GGTTTTCAGGGGCTGGGGTTGGG - Intergenic
920259140 1:204677255-204677277 GTCTTCCAGGGGGTTGTGCTGGG + Intronic
1067285003 10:44901519-44901541 GTTTTTCAGGGCATTGTCCTAGG - Intergenic
1069602431 10:69716672-69716694 GCTTTTCAGGTGACTGTGATGGG + Intergenic
1070955348 10:80459923-80459945 CTTTTTCTGGGGCTTGTTAGGGG + Intronic
1071147844 10:82596320-82596342 GCTTTTAGGGGACTTGTGATTGG + Intronic
1071815784 10:89231583-89231605 GTTCTTCAGGGGCCTGAGGTGGG - Intronic
1072824628 10:98594308-98594330 GTATATCATGGGCTTGTGGTGGG - Intronic
1072939898 10:99752440-99752462 ATGTTTCAAGGGCTTGTTATAGG - Intronic
1077514308 11:2992438-2992460 TTTCTTCGGAGGCTTGTGATTGG - Intergenic
1078674111 11:13393390-13393412 CTTTTTAAGGGACTTGGGATTGG + Intronic
1082811021 11:57479090-57479112 GTCTTGCAGGGGCTTGTGTCAGG + Intergenic
1082899592 11:58232205-58232227 GTTTTTCTAGGGATTTTGATAGG - Intergenic
1084063182 11:66688828-66688850 GTTTTGGAGGTGCTTGTGTTTGG - Exonic
1084871919 11:72104082-72104104 GTTGTTCATGAGCGTGTGATTGG + Intronic
1086268241 11:85028248-85028270 GGTTTTCATGGGCTTCAGATGGG + Intronic
1086719700 11:90104889-90104911 TTTTTTCAGGGGCTTATCCTGGG - Intergenic
1088136528 11:106562295-106562317 GTTTTACAAGGGCTTCTGTTAGG - Intergenic
1088544446 11:110945698-110945720 GTTCTTCAGGGGCTTCTCAGTGG + Intergenic
1088902312 11:114127571-114127593 GCTTTTCAGGTGCTTGTGGATGG + Intronic
1089600806 11:119613607-119613629 GTATTTCATTGGCTTCTGATTGG - Intergenic
1089857028 11:121554706-121554728 GTATTTGAGGGGCTTGGGGTGGG + Intronic
1090240842 11:125180561-125180583 GTACTTCAGGGGCTTGTGAAAGG + Intronic
1091729384 12:2868805-2868827 GTTCTTCAAGGGCTTGGGTTGGG - Intronic
1095906763 12:47386066-47386088 GTCTTTCAGTTGCTTGTGCTTGG - Intergenic
1096610406 12:52797226-52797248 GTTGTTCAGAGGCTTATGACTGG + Intergenic
1098097392 12:66973286-66973308 GTTATTCAGGGGTTTGGGGTAGG + Intergenic
1099381123 12:81954080-81954102 ATTTTTACTGGGCTTGTGATGGG - Intergenic
1099620379 12:84996201-84996223 ATTTTTAAGGGGATTGTGAAGGG - Intergenic
1101365683 12:104067825-104067847 GTTTTTTAGTGCCTTCTGATGGG + Intronic
1102757233 12:115352085-115352107 GGTTTTCAGGGGCTAGTGGAGGG - Intergenic
1104219660 12:126769936-126769958 GTTCTTCACTGGCTTTTGATAGG + Intergenic
1106660198 13:31791430-31791452 GACTTTCAGGGGCTTGGGCTTGG - Intronic
1107514683 13:41117663-41117685 GGTTTTCAGGGGCTGGGGATAGG - Intergenic
1108259269 13:48640798-48640820 GGTTTTCAGGGGTTTGAGAAGGG + Intergenic
1108871944 13:54998796-54998818 GTTGTGCAGGGGCTTGGGAATGG + Intergenic
1111519285 13:89379157-89379179 GATTTTGATGGGCTTGGGATGGG - Intergenic
1114958049 14:27848338-27848360 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1116640101 14:47450794-47450816 TTTTTTCAAGTGATTGTGATTGG + Intronic
1117516313 14:56505298-56505320 GTCTTTCAGGGGCTGGTGGAGGG + Intronic
1121056290 14:90856829-90856851 GTTTTTCAGGGGCTGGTGGGAGG - Exonic
1121077607 14:91082364-91082386 GTTGTTCTTGGGCTTGTGTTTGG + Intronic
1121085615 14:91144039-91144061 GTTTTTCCAAGGCTTGTGAGTGG - Intronic
1122080820 14:99266366-99266388 GTTATTAAGGCGCTGGTGATCGG - Intronic
1122767759 14:104083551-104083573 GATTTTCAGGGGGCTGTGATGGG + Intergenic
1123939831 15:25211448-25211470 TTTTTTCAGGGTTTGGTGATGGG + Intergenic
1123940271 15:25213311-25213333 GTTTCTCAGGGTTTGGTGATGGG + Intergenic
1123942837 15:25224866-25224888 TTTTTTCAGGGTATGGTGATGGG + Intergenic
1128372267 15:67049081-67049103 GTTTTCCCTGGGCTTGAGATGGG - Intergenic
1128887812 15:71304369-71304391 GTTTCTCTGGGGCTTCTGCTTGG + Intronic
1129155282 15:73713747-73713769 GTTCTCCAGGGGTCTGTGATGGG + Exonic
1138837863 16:60459914-60459936 GTTTTTAAAGGTCTAGTGATCGG - Intergenic
1146498455 17:33343860-33343882 GCTTTTCAGGGGCTTCTGTGGGG - Intronic
1146679370 17:34796095-34796117 GTTTTTGAGTGGCTTGAGAAGGG - Intergenic
1146897472 17:36554697-36554719 TTTTTTGAGGGGCTAGGGATGGG + Intronic
1146987966 17:37240322-37240344 GTTTTTAAGGGAGTAGTGATAGG + Intronic
1147643663 17:42020485-42020507 GCTTTTGGGGGGCTTGTGTTTGG + Intronic
1148283305 17:46365954-46365976 TTTATTCAGAGGCTTGTGAAAGG - Intergenic
1148305523 17:46583875-46583897 TTTATTCAGAGGCTTGTGAAAGG - Intergenic
1148474398 17:47917379-47917401 TTTTTTCAGGGGATGGTGAGGGG + Intronic
1152306366 17:79523112-79523134 GGTTGCCAGGGGCTTGTGGTGGG + Intergenic
1152506561 17:80753187-80753209 GTTTTTCAGTCTCTTTTGATGGG + Intronic
1154110190 18:11561149-11561171 GTTTTTCAGGGGCTGGGGTGGGG - Intergenic
1155283063 18:24260625-24260647 GGTTTTCAGGGACTGGGGATGGG + Intronic
1156058107 18:33035599-33035621 GTTTCGCAGGGGCTGGGGATTGG + Intronic
1157390708 18:47300617-47300639 GAATTTCTGGGGCATGTGATAGG + Intergenic
1160552670 18:79705047-79705069 GTTGTGCAGGGGGTTGTGAGAGG + Intronic
1161652049 19:5491511-5491533 GTTTTTCAGGGGCCAGTGGCTGG + Intergenic
1164821697 19:31255859-31255881 GTTGCTCAGGGGCTAGTGTTGGG + Intergenic
1165492497 19:36132749-36132771 CTTTCTCAGAGGCTTGTGAGAGG + Intergenic
925649690 2:6076629-6076651 GTTTCTCACGGGCATATGATGGG + Intergenic
927870594 2:26620415-26620437 CTTTTGCAGGGGCTGGGGATGGG - Intronic
928469576 2:31560554-31560576 GTTTTTCAGGGGCCTATATTGGG - Intronic
928761181 2:34584971-34584993 GTTTTTCAGGAGCTGGTGTGAGG + Intergenic
929359884 2:41074687-41074709 GTTTTTCTGTGGTTTGTGGTTGG + Intergenic
930862201 2:56086651-56086673 TTTCTTCAGGGGCTTATGAAAGG - Intergenic
933541032 2:83643051-83643073 GTTTTTTATGGGCATTTGATTGG + Intergenic
934479252 2:94619706-94619728 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
934724696 2:96608398-96608420 TTTTTTCAGGGGGATGTGAGAGG - Intronic
936071985 2:109377174-109377196 GCTTTTCAGGGGCATGTGATGGG + Intronic
936747691 2:115599014-115599036 GTTCTTCATGGGTTTCTGATGGG + Intronic
938784430 2:134612138-134612160 CTTTTTCAGGTGCTTGAGATAGG - Intronic
939444669 2:142292912-142292934 GTTATTCAGGGGCCTGAGACAGG - Intergenic
939450857 2:142372785-142372807 GTTTTTCAAGCAATTGTGATGGG + Intergenic
941044890 2:160663490-160663512 GGTTGTCAGAGGCTTGGGATGGG + Intergenic
943992219 2:194711127-194711149 GTATTTCAGTGGATTGTGAAAGG + Intergenic
944855123 2:203760000-203760022 GTTTTTCAGGAGCTAGTGCCTGG + Intergenic
945346137 2:208719216-208719238 GTTTATCAGGGGCTGGGGATAGG - Intronic
945352234 2:208794857-208794879 GTTTGTCAGGGGCAAGGGATGGG + Intronic
1169024350 20:2355950-2355972 GGTTGTCAGGGGCTTGGGGTGGG + Intergenic
1169267341 20:4174706-4174728 GAATTTCAGGGGCTTAAGATGGG + Intronic
1172779410 20:37426954-37426976 GTTCTCCAGGGGCTGGTCATTGG - Intergenic
1175713280 20:61238170-61238192 GGTTTCCAGGGGCTTGGGAAGGG + Intergenic
1178297968 21:31426882-31426904 GTTTTTGAGGGGCTTGGGGTGGG + Intronic
1181989250 22:26824607-26824629 CTGTTTCAGGTCCTTGTGATTGG + Intergenic
1182194390 22:28500192-28500214 GGTTTTCAGGAGCTTGGGGTAGG - Intronic
1184987000 22:48142517-48142539 CTGTTTCAGGGGCTGGTGACGGG + Intergenic
952173932 3:30841027-30841049 GTTTTTCAATGGATTGTCATAGG + Intronic
953284825 3:41596450-41596472 TGTTTTCAAGGGCTTGAGATGGG + Intronic
953678270 3:45020250-45020272 GGTTTCCAGGGGCTTGGGGTGGG - Intronic
954775433 3:53013073-53013095 GATTTTCAGATGATTGTGATTGG - Intronic
955471403 3:59290239-59290261 GTTTTTCTTGGGCTTGGGAAAGG + Intergenic
955911270 3:63862736-63862758 GTTTTTCAGGAGATGGTGACCGG - Intronic
959112900 3:102143217-102143239 GTTGTTATGAGGCTTGTGATAGG - Intronic
961802238 3:129460223-129460245 GGTTTTCAGGGGCTGGGGGTAGG - Intronic
962050878 3:131814409-131814431 GATTGGCAGGGGCTTGTGACTGG - Intronic
964194020 3:154040723-154040745 GTTTGTCAAGGGCTAGGGATTGG + Intergenic
969659189 4:8516461-8516483 GTTTTTCAGGGAATGGTGAAGGG - Intergenic
969874717 4:10127553-10127575 GTTTCTCAGGGGGTTGTGGCAGG + Intergenic
975150019 4:71010838-71010860 GTTTTTCAGTGGCTTATTAGTGG - Intronic
975331128 4:73114866-73114888 GGTTTTCAGAGGCATGTGTTAGG + Intronic
975754185 4:77556786-77556808 GGACTTCAGGGGCTTGTGCTGGG - Intronic
976080282 4:81347251-81347273 GTTTTTCTGAGGCTTGTGGCTGG + Intergenic
978094226 4:104755688-104755710 GTTTGCCTGGGACTTGTGATAGG + Intergenic
980089161 4:128423887-128423909 ATTGTTCAGGGCTTTGTGATGGG - Intergenic
981812590 4:148792800-148792822 GTTTTTCAGGGAAGTGTGGTAGG - Intergenic
983593626 4:169441712-169441734 GCTTTCCAGGGGCTTGGGAAAGG + Intronic
986004335 5:3655611-3655633 GGTTCCCAGGGGCTGGTGATGGG - Intergenic
986476066 5:8134788-8134810 GTTTTTCAGGGGCTGGCACTGGG - Intergenic
986649911 5:9953088-9953110 GTGATTAAGGGGCTTGAGATGGG - Intergenic
986940606 5:12944685-12944707 GTGTTTCAGGGACTTGTCTTTGG + Intergenic
988391208 5:30634594-30634616 GTTTTTTAGGGGCTTGAGGAAGG - Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
990664727 5:58059465-58059487 TTTTTCCAGGGGCTGGTGGTGGG + Intergenic
991092701 5:62708391-62708413 GTTTTTAAGGGAATTGTGAAGGG + Intergenic
992575220 5:78101425-78101447 ATTTTTGATGGGCTTGTGATAGG + Intronic
992784692 5:80158233-80158255 GTGTTTCAGATGCTTGTGGTGGG - Intronic
993734199 5:91456790-91456812 GTTTTTCAGGGGATAGGGAGGGG - Intergenic
993805417 5:92402168-92402190 GTTCTTCAGGTGATTCTGATTGG + Intergenic
994798480 5:104338318-104338340 ATTTTTCAGGGGATTGTGTTAGG - Intergenic
995360187 5:111288308-111288330 GTTTCTCTGGGGTTGGTGATTGG + Intronic
995556503 5:113334974-113334996 GATTTTCAGGGAATTGGGATAGG - Intronic
995901415 5:117072136-117072158 GTTTTACTGGGGCTTCTGGTAGG + Intergenic
996076036 5:119195559-119195581 GGTTTTCAAGGGCTGGTGGTGGG + Intronic
996365229 5:122694027-122694049 GTTGTTCAGGGCATTGTGCTAGG - Intergenic
997235395 5:132269441-132269463 GTTTCTCAGGGGCTTTTGTTGGG + Intronic
1002220518 5:177676399-177676421 GTTTTTCAGGGGTTGGGGAAGGG + Intergenic
1002645485 5:180650917-180650939 GTTGGTGAGGGGTTTGTGATGGG - Intergenic
1002971961 6:2032188-2032210 GTTTTTCTGGTGCTGGTGATAGG + Intronic
1007943053 6:45800117-45800139 GTTTTGCAGAAGGTTGTGATTGG + Intergenic
1008690549 6:53973882-53973904 TTTTTTCCTGGGCTTGTGATAGG + Intronic
1009678699 6:66862319-66862341 GCTTGCCAGGGGCTTGAGATGGG - Intergenic
1010380574 6:75219486-75219508 GATTTTTAGGGGCTGGAGATGGG + Intergenic
1011148847 6:84246160-84246182 GTTTGCCAGGGGCTGGGGATAGG + Intergenic
1013127429 6:107198058-107198080 GTTTTACAGGAATTTGTGATAGG - Intronic
1016213188 6:141565487-141565509 GCTGTTCTGGGGCTAGTGATTGG + Intergenic
1020093539 7:5354984-5355006 GTGTGTCTGGGGCTTTTGATTGG - Intronic
1021482547 7:21133448-21133470 GTTTTTCTGGGGTTTATGATTGG - Intergenic
1022751104 7:33226871-33226893 GGTTTCCAGGGGCTTGGGAAAGG + Intronic
1023666738 7:42530448-42530470 TTCTTTCAGGAGCTTGTGAAAGG - Intergenic
1023905277 7:44517320-44517342 GTTTTTCAGGGGCTTGTGATAGG + Exonic
1026130071 7:67612872-67612894 GGTTTTCAGGGACTGGGGATGGG + Intergenic
1026287280 7:68974354-68974376 GTTTTTCTGGGGCTCATGGTTGG - Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027154634 7:75757922-75757944 CTTTTTCACAGTCTTGTGATGGG + Intergenic
1028534199 7:91873485-91873507 GTTATTAAGGGCCTTGAGATGGG - Exonic
1031739115 7:125405776-125405798 GGTTTTCAGGAGCTTGTCATGGG - Intergenic
1032356581 7:131216684-131216706 GTCTTTCAGGTCCTTGTGCTTGG + Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1035205059 7:157289756-157289778 GTTTCTCAGGGGCTGGGGTTGGG + Intergenic
1035483672 7:159205958-159205980 GTTTTTCAGGAGTTTGGGAAAGG + Intergenic
1035628025 8:1088497-1088519 GTTTTTCATGCCCTTGAGATGGG + Intergenic
1041719290 8:60961701-60961723 GTTTTCCAGGGGCTGGGGCTGGG + Intergenic
1043369920 8:79578754-79578776 GATTATCAGAGGCTTGGGATGGG - Intergenic
1043566481 8:81554336-81554358 GTTTTTGAGGGGATTGAAATAGG - Intergenic
1045103453 8:98867859-98867881 GTTTACCAGGGGCTTATTATAGG - Intronic
1047268937 8:123336333-123336355 TTTTTTCAGGGGGTTGAGTTGGG - Intronic
1048039632 8:130713350-130713372 GTTTTTCAGAGGCTTGGGAGAGG - Intergenic
1049499951 8:142956887-142956909 GCTTTTCCTGGGCTTTTGATAGG - Intergenic
1052334984 9:27309905-27309927 GGTTATCAGGGGCTGGTGGTGGG + Intergenic
1053678577 9:40463859-40463881 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1053928562 9:43092213-43092235 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054285147 9:63161083-63161105 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054291655 9:63299397-63299419 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054389671 9:64603940-64603962 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054506041 9:65912436-65912458 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1055587478 9:77770380-77770402 GTTTTTTGGGGTCTTGGGATGGG - Intronic
1058266726 9:102908789-102908811 GGTTTTCAGGGGCTGATGAGAGG - Intergenic
1058792411 9:108463401-108463423 GGTTTTCAGGGGCTGGAGGTAGG + Intergenic
1061243748 9:129390464-129390486 GTTATTCAGGGGGCTGAGATGGG + Intergenic
1186545805 X:10448290-10448312 GTTTTTCAGTGACTTATGTTTGG + Exonic
1188842533 X:35034226-35034248 GTTTACCAGGGGCTGGTGAGAGG + Intergenic
1190434291 X:50408202-50408224 GTTGTGCAGGGGCTTGTGGGGGG + Intronic
1190799391 X:53773340-53773362 TTTTTTCCTGGGCTAGTGATAGG + Intergenic
1192596058 X:72409547-72409569 GTTTTTCAAGTACATGTGATAGG - Intronic
1192677723 X:73216108-73216130 GGTTTTCAGAGGCTTGGGGTAGG + Intergenic
1193473534 X:81935278-81935300 CTTTTGCAGGGACTTGTCATGGG - Intergenic
1194620706 X:96167657-96167679 GTTATTAAGTGTCTTGTGATAGG + Intergenic
1194762714 X:97813656-97813678 GTTTTTCAGGGAATTTTGATGGG - Intergenic
1198505819 X:137300478-137300500 GTTTGTCAGGAGCTAGGGATAGG + Intergenic
1199557273 X:149122969-149122991 GTCTTTTAGGGTTTTGTGATGGG - Intergenic
1200910424 Y:8526971-8526993 GTTTTTGAGGGATTTTTGATGGG - Intergenic
1201192100 Y:11453165-11453187 TTTTTTCAGGGGCCTATGTTGGG - Intergenic