ID: 1023906219

View in Genome Browser
Species Human (GRCh38)
Location 7:44523474-44523496
Sequence TGAGGCTGGGAGTGGCAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 1, 2: 2, 3: 36, 4: 340}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023906219_1023906227 29 Left 1023906219 7:44523474-44523496 CCCATTTGCCACTCCCAGCCTCA 0: 1
1: 1
2: 2
3: 36
4: 340
Right 1023906227 7:44523526-44523548 GCAGCTTGTACACAGCTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023906219 Original CRISPR TGAGGCTGGGAGTGGCAAAT GGG (reversed) Intronic
900546986 1:3234745-3234767 TGAGTCAGTGAGTGGAAAATGGG - Intronic
901328253 1:8382869-8382891 TGAGGATGGAAGTGCCAAAAAGG + Intronic
902044669 1:13515262-13515284 TGGGGATGGCAATGGCAAATTGG - Intergenic
902641028 1:17766305-17766327 TGAGGCTGGGACTGGTACTTTGG + Intronic
902658957 1:17888062-17888084 TAAGCCCGGGAATGGCAAATTGG + Intergenic
902818477 1:18929346-18929368 TGGGGGAGGGAGGGGCAAATGGG + Intronic
904346570 1:29875932-29875954 AGAGGCTTGTAGTGGAAAATGGG - Intergenic
904473088 1:30747837-30747859 TGAGGCGGGGAGTGGCTGTTGGG + Intronic
904505240 1:30947468-30947490 TGAGTCTGTGAGTAGGAAATGGG + Intronic
905259577 1:36707988-36708010 TGAGGCAGGGAGAGCCAAAGGGG - Intergenic
905275955 1:36818442-36818464 GGAGGCTGGGAGTGGCCAGTTGG - Intronic
905405255 1:37728207-37728229 GAAGGCGGAGAGTGGCAAATAGG + Intronic
905504337 1:38465276-38465298 TGAGGGTGGAAATGGCAAATGGG + Intergenic
906478455 1:46185321-46185343 GGAGGCTGGGACTGGGACATGGG + Intronic
906607216 1:47180992-47181014 GGAGGCTGGGAGAGACAAAGAGG + Intergenic
906940308 1:50249909-50249931 TGATGCTGGGAGCAGCAAGTTGG - Intergenic
907356452 1:53878870-53878892 TCAGGCTGAGAGTTGCGAATTGG - Intronic
908501322 1:64745624-64745646 TGAGGCTCTGAGTGGCGAAGCGG + Intronic
908641571 1:66229350-66229372 TGAGGCTGAGAGTGTCCAAGTGG - Intronic
909332785 1:74434371-74434393 TGAGGCTGGAAGAGACAAAGGGG - Intronic
911905058 1:103556679-103556701 TGAGGATGGGAGTAGCATAGAGG + Intronic
912958566 1:114174327-114174349 ATAGGCTGAGAGTGGCAAAGAGG + Intergenic
913433971 1:118827630-118827652 AGAGGCTGAGAGAGGGAAATTGG - Intergenic
915147645 1:153804676-153804698 TGGGGCTGGGGGTGGCAGTTTGG - Intergenic
916821982 1:168408683-168408705 TGAGAAAGGGAGTGGCAAAGTGG + Intergenic
917965771 1:180177631-180177653 TGAGGGTGGGAGTGGGGAAAGGG + Intronic
917999558 1:180479480-180479502 AGAGACTGGGAGGGGCAAGTAGG + Intronic
918042891 1:180923938-180923960 TGGGGCTGGGAGTGGTAAGGGGG - Intronic
920052201 1:203171037-203171059 TGAGGCTGGCTGAGGCAAAGTGG - Intronic
920539193 1:206764773-206764795 GGAGTCTGGGAGTGACAACTAGG - Intergenic
920594207 1:207252236-207252258 TGGGGGTGGGAGTGGGAAATGGG - Intergenic
920694000 1:208167881-208167903 TGGGGTGAGGAGTGGCAAATGGG - Intronic
921411401 1:214839985-214840007 TGAGGGAGGGAGTGGGAAAAGGG - Intergenic
923160501 1:231310578-231310600 GGAGGCTGGGAGTGGGCAGTGGG + Intergenic
923307268 1:232699590-232699612 TGAGGCTGGGTGTGGCCATGTGG - Intergenic
924701952 1:246463094-246463116 TGAGGCAGGGAGGGACACATAGG + Intronic
1065290720 10:24226909-24226931 TGAGACTAGGAGTGGAAAGTTGG - Intronic
1067444153 10:46330047-46330069 TGAGGGGGGGAGTGACAAAGGGG - Exonic
1068386908 10:56341771-56341793 TAGGGCAGAGAGTGGCAAATTGG - Intergenic
1070292058 10:75123570-75123592 TGAGGGTGGGAGTGGAAATGGGG + Intronic
1070913869 10:80140312-80140334 TGAGGTTGGGGGTGGAAACTTGG - Intronic
1070935632 10:80292723-80292745 TGGGGCTTGGAGTGGCCATTGGG - Intergenic
1072077117 10:91987987-91988009 TGAGGTAGGGAGTGGAAAACAGG - Intronic
1072921863 10:99583493-99583515 TGAAGCTGGGAGAGGCTAAGCGG + Intergenic
1073190078 10:101644861-101644883 TGAGGTTTTGGGTGGCAAATGGG - Intronic
1074190854 10:111135568-111135590 AAAGGCAGGGAGTGGCAAGTTGG - Intergenic
1075307050 10:121377486-121377508 TGGGGCTGGGAGAGGGAAAGGGG - Intergenic
1076065082 10:127442208-127442230 TGAGGCTGGAAGGAGGAAATGGG - Intronic
1077341066 11:2026565-2026587 TGAGGCTGAGAGTGGGATCTGGG + Intergenic
1078189689 11:9082808-9082830 TGAGGCTGGGACTGGGAATGAGG + Intronic
1078413001 11:11143049-11143071 TGAGGCTTGCAGTTGCAGATGGG + Intergenic
1078467603 11:11561764-11561786 TGAGGCAGGGAGTGGCCCATTGG + Intronic
1079047310 11:17117145-17117167 AGTGGCTGGGAGGGGAAAATGGG + Intronic
1082039324 11:47671986-47672008 TGAGGCAGAGGCTGGCAAATTGG + Intronic
1083109454 11:60390653-60390675 TGGGGGTGGGAGAGGCATATTGG + Intronic
1083429529 11:62606932-62606954 TGTGGCTGGGAGGGGCATCTGGG - Intronic
1083729446 11:64644896-64644918 TGGAGCTGGGGGTGGCACATGGG - Intronic
1083761410 11:64820471-64820493 TGAGGCTGGGAGTTCAACATCGG - Intergenic
1084045390 11:66565044-66565066 TCTGGCTGTGAATGGCAAATGGG - Intronic
1085705225 11:78781063-78781085 TGAAAATGGGAGTGACAAATGGG + Intronic
1087295877 11:96373062-96373084 AGAGGCTGGGTTTGGCACATGGG + Intronic
1089498843 11:118921482-118921504 TGAGGCTGGGGGTGGGGAAGTGG + Intronic
1090083183 11:123628041-123628063 TGAGGCTTGGAGTGACAGATGGG - Intergenic
1091216353 11:133904751-133904773 TGAGGCTGGAAGGGGCACAGAGG - Intergenic
1091346021 11:134854734-134854756 TGGGGCTGGGAGTGGAGAACTGG + Intergenic
1202824051 11_KI270721v1_random:81754-81776 TGAGGCTGAGAGTGGGATCTGGG + Intergenic
1091677991 12:2505173-2505195 TGAGGCTGGGAGGGGCCAGCTGG - Intronic
1092069155 12:5618665-5618687 TTAGACTGGGAGTGGAAAGTGGG - Intronic
1093002893 12:14018106-14018128 TGGGGCTGGGAGTGGGAGAAGGG - Intergenic
1093204549 12:16231743-16231765 TGAGGCTGAAAATGGAAAATGGG + Intronic
1093674454 12:21920694-21920716 GGGTGCTGGGAGAGGCAAATGGG - Intronic
1096652646 12:53069458-53069480 TGAGGCTGGGAGTGGGGATGCGG - Intronic
1097043637 12:56171452-56171474 TGAGGCTGGGAGCGGCACAGTGG + Intronic
1097897784 12:64842844-64842866 TGAGGCGAGGAGTGCCAAGTAGG + Intronic
1098869971 12:75806011-75806033 TAAGGCTGTGAATGGCAAACTGG - Intergenic
1101323921 12:103698071-103698093 TGAGGCTGGGTGATGCCAATAGG + Intronic
1104132208 12:125905100-125905122 TGAGGCTGGGCCTGGCCATTGGG + Intergenic
1105636189 13:22217508-22217530 TGTGGCTGTGTGTGACAAATGGG - Intergenic
1106769749 13:32950543-32950565 TGAGGCTGGGAGAGGTGAAGGGG + Intergenic
1107415295 13:40194331-40194353 TGAGGCTGGAAGTGGCCGAGCGG - Intergenic
1107475457 13:40731331-40731353 GGAGGCTGGGGGTGGCAGGTAGG + Intronic
1109530853 13:63644435-63644457 GGAGGATGGGAGTGCAAAATGGG + Intergenic
1110769697 13:79327055-79327077 TGAGGCTGAGACAGGCAGATTGG + Intronic
1111019845 13:82435123-82435145 TGAGTGAGGGAGTGGGAAATGGG - Intergenic
1112046364 13:95602052-95602074 TGAGGCTGGGTGTGCAGAATTGG - Intronic
1112686698 13:101837285-101837307 TTAGGCCAGAAGTGGCAAATCGG - Intronic
1114290675 14:21285882-21285904 GGAGGATGGGAGAGGAAAATGGG + Intergenic
1115429366 14:33298883-33298905 TGTGGTTGGGGTTGGCAAATAGG - Intronic
1116023567 14:39489422-39489444 AGAGGTTGGGAGTGTAAAATTGG + Intergenic
1116551538 14:46246078-46246100 TGAGGGTAGGGGTGGGAAATTGG - Intergenic
1117200349 14:53383775-53383797 TGAGGCTGGATGTAGGAAATGGG - Intergenic
1117467484 14:56007755-56007777 TGAGGCTGGGTGTGGCAGAGAGG + Intergenic
1117711375 14:58532395-58532417 TTAGGATGGGAGTAGCCAATGGG + Intronic
1118318701 14:64741050-64741072 TGAGGCTGGGAGTGAGCAAGAGG + Exonic
1118778786 14:68992230-68992252 TGAGGCTGTGAAGGTCAAATGGG + Intergenic
1120183495 14:81368919-81368941 TGAGGTTGGAAGCGGCAAACAGG - Intronic
1120871692 14:89343340-89343362 TGAGGCTGGGAATAGTAGATAGG - Intronic
1121726665 14:96157264-96157286 TGAAACTGGGAGGGGCAACTTGG - Intergenic
1122415699 14:101548572-101548594 AGAGGCTGGGAGGGGCAGGTGGG + Intergenic
1122462035 14:101903888-101903910 TGAGGCTGGGAGTTGAAGATCGG - Intronic
1122939224 14:104973800-104973822 TGAGGGTGGGAGTGGCATCGGGG - Intronic
1123180453 14:106465320-106465342 GGAGGGTGGGAGTGGCATGTGGG + Intergenic
1202946443 14_KI270726v1_random:31343-31365 GGAGGGTGGGAGTGGCATGTGGG - Intergenic
1124148144 15:27150279-27150301 GGGGAGTGGGAGTGGCAAATGGG + Intronic
1124338741 15:28876390-28876412 GGAGGCTGGGAGTTCCAAATGGG - Intergenic
1124853116 15:33360273-33360295 TGGGGCTGGGAGTGGGAGATGGG - Intronic
1125034336 15:35106654-35106676 TCAGACTGGGCCTGGCAAATAGG - Intergenic
1125131702 15:36290318-36290340 TGAGGTTGGGCGTGGCAATAAGG + Intergenic
1125500651 15:40238731-40238753 GAAGGCTGAGAGTGGCACATGGG - Intergenic
1125921503 15:43528207-43528229 TGAGGCAGGTCGTGGCAGATTGG - Exonic
1126351026 15:47744950-47744972 CGAGGCTGGAAGAGGCAAGTTGG + Intronic
1126925626 15:53583087-53583109 AGAACCTGGGATTGGCAAATAGG + Intronic
1127236589 15:57059551-57059573 TAGGTCTGGTAGTGGCAAATGGG + Intronic
1129364378 15:75045201-75045223 TGAGGTGGGGGGTGGCAATTAGG - Intronic
1129647411 15:77449218-77449240 TGAGGTAGGGAGAGGCAATTAGG - Intronic
1131708109 15:95020682-95020704 TGAGGATGGGGGTGGCAGGTTGG - Intergenic
1132360868 15:101214199-101214221 TGCGGCTGGGTTTGTCAAATAGG - Intronic
1132693824 16:1193345-1193367 GGAGGCTGGGAGAGGCCAAGGGG + Intronic
1133081569 16:3325218-3325240 GGAGGCTGAGGGTGGCTAATCGG - Intergenic
1135501349 16:22998652-22998674 TGAGGCAGAGATTGGCAAGTAGG - Intergenic
1136070151 16:27782646-27782668 TGAGGCTGGGAGAGGGAACCCGG - Intergenic
1138507654 16:57486267-57486289 TGAGGCAGGGAGGGGGACATAGG - Intronic
1139562926 16:67755220-67755242 TCAGGGTGGGAGTGGGAAAAGGG - Intronic
1139964786 16:70739284-70739306 TGAGGCTGGGAGGGGTGAGTGGG + Intronic
1140816891 16:78629491-78629513 TTAAGCAGGGAGTGGCAAGTAGG - Intronic
1141415666 16:83871042-83871064 AGGGGCTGGGTGGGGCAAATGGG - Intergenic
1142192944 16:88726223-88726245 TGGGGCTGGGAGGGGGCAATGGG - Intronic
1142746741 17:1963192-1963214 TGAGGCTGGGGAGGGCCAATGGG - Intronic
1144515504 17:15915139-15915161 GGAGGCTGGGAATGGCAAGAAGG - Intergenic
1144671482 17:17135003-17135025 TCAGGATGGGAGTGGGAAGTGGG + Intronic
1145978093 17:28995954-28995976 AGAGGCTGGGAGAGGCAGAAAGG - Intronic
1146272749 17:31495099-31495121 GGGGGCTGGCAGTGGCAGATGGG - Intronic
1147138446 17:38448210-38448232 TGAGGCTGGCAGTGGGAGGTGGG + Intronic
1147426494 17:40348211-40348233 TGAGGCTGGGAGAGGCTCTTAGG + Intronic
1147782838 17:42956122-42956144 TGGGGCTGGGAGTGGGAGAGGGG - Intronic
1147987355 17:44314339-44314361 TCAGGCTGGGTATGGCCAATTGG - Intronic
1148643661 17:49206598-49206620 TGAAGGTGGGAGTGGGGAATGGG + Exonic
1148759508 17:49992373-49992395 TGAGGCTGTGAGTGGGAACGTGG - Intronic
1148773065 17:50078007-50078029 GGAGGCAGAGAGTGGCATATGGG - Intronic
1148898080 17:50852100-50852122 TGGCGATGGGAGTGGCAACTGGG + Intergenic
1148993323 17:51685333-51685355 ATAGGCTGGGAGTGGGAGATGGG + Intronic
1150258733 17:63771502-63771524 TGAGGCTGGCATTGACAAAGTGG - Intronic
1150386010 17:64760957-64760979 AGAGGCTGGGAGGGGCATAAGGG - Intergenic
1150631229 17:66881806-66881828 TGGGGGTGGGGGTGGAAAATGGG + Intronic
1152326866 17:79646733-79646755 TGGGGTTGGGGGTAGCAAATGGG - Intergenic
1152349254 17:79774666-79774688 TTGGCCTGGGAGGGGCAAATGGG - Intergenic
1152806123 17:82357207-82357229 TGAGGCTGGGAGGGGCCAGGTGG + Intergenic
1153385068 18:4483763-4483785 TGACCTTGGCAGTGGCAAATTGG - Intergenic
1155489890 18:26390288-26390310 TGAGGCAGGTAGTAACAAATAGG - Exonic
1155491965 18:26408454-26408476 TGAGGATGGGCCTGGTAAATGGG - Intergenic
1155928318 18:31680840-31680862 TAGGGCTTGGAGTGGCACATGGG - Intronic
1157595446 18:48861133-48861155 TGAGTCTGAGAGTGGCGAGTGGG + Exonic
1159150929 18:64522876-64522898 TGAAAGTGGGAGTGGGAAATGGG + Intergenic
1160011835 18:75111921-75111943 GGGGGCAGGGAGTGGCACATGGG - Intergenic
1161642805 19:5434991-5435013 TGAGGCTGGGACTGCAGAATTGG + Intergenic
1161806732 19:6448163-6448185 TGCGGCTGGGAGAGGCTTATAGG + Intronic
1163003245 19:14381971-14381993 TGAGACTGCGAGGGACAAATTGG - Intronic
1163687939 19:18722771-18722793 TGGGGCTGGGAGTGGAAATGGGG - Intronic
1163712371 19:18854338-18854360 GGTGGCTGGGAGTGGCAAGGAGG + Intronic
1164535465 19:29083603-29083625 TGAGTCTGGGAGGGGCACATGGG + Intergenic
1165667699 19:37647982-37648004 TGGGGGTGGGAGTTGCATATAGG - Intronic
1166365375 19:42275525-42275547 TGAGGCTGGGGGTGGAAGAGTGG + Intronic
925140538 2:1547128-1547150 TGGGGCTGGGAGAGACAAGTAGG + Intergenic
925348549 2:3186561-3186583 TGGGGCTGGCATTGGCAAACAGG + Intergenic
925966510 2:9071796-9071818 TGAGGCTGGGAAGGGCAAGCAGG - Intergenic
926187143 2:10699510-10699532 CGAGGCGGGGGGTGGTAAATGGG + Intergenic
926518081 2:13874857-13874879 TGAGCCTGGGATAGGCAAATAGG - Intergenic
927882792 2:26700447-26700469 TGAGGCTGGCTCTAGCAAATGGG - Intronic
928135045 2:28681699-28681721 TGGGGCTGGGGGTGGCACAGGGG + Intergenic
929997199 2:46836086-46836108 TGAGGCTGGGAAAGGCTAAGTGG + Intronic
932714165 2:74089640-74089662 TGTTGCTGGGAGTAGCACATGGG - Intronic
934566186 2:95342873-95342895 TGAGGCTGGGAAAGGAAATTGGG + Intronic
934730323 2:96652475-96652497 TGAGGCTGGGGGTGGCGGAGAGG + Intergenic
936234229 2:110729994-110730016 AGAGGCTGGGAGGGGCAAGGAGG - Intergenic
937237009 2:120437129-120437151 TGAGCCTGGGAGGGGCAGAGTGG + Intergenic
937353190 2:121180944-121180966 AGGGACTGGGAGTGGGAAATGGG + Intergenic
937938651 2:127267552-127267574 AAAGACTTGGAGTGGCAAATTGG - Intronic
937989149 2:127652801-127652823 TGGGGCTGGGAGGGCCAAGTAGG + Intronic
938153355 2:128905052-128905074 AGAGGAAGAGAGTGGCAAATAGG - Intergenic
938265755 2:129927014-129927036 TGAGGTTGGGAGTGGAAACTTGG + Intergenic
939395121 2:141619131-141619153 TGAGGTGGGGAGTGGCATAAAGG - Intronic
939644419 2:144679148-144679170 TGAGGCATGCACTGGCAAATAGG - Intergenic
940206220 2:151204814-151204836 TGAGGGTGGGAGTGGTGAATGGG - Intergenic
941091538 2:161182343-161182365 GGAGGCTGGGACTTGCAACTTGG - Intronic
941245918 2:163097157-163097179 TGAGGCTGGAGGTGGAAAATTGG - Intergenic
941385851 2:164851224-164851246 TGGGGTTGGGGGTGGAAAATGGG - Intergenic
942547356 2:177078964-177078986 TGAAGGTGGGAGTTGCAAACTGG - Intergenic
942555666 2:177170213-177170235 TGAGGCAGGCAGTGGCACAGTGG + Intergenic
943046915 2:182870635-182870657 TGGGGCAGGGAGGGGGAAATTGG - Intergenic
943758496 2:191584061-191584083 TTAGGGTGGGAGTTACAAATGGG + Intergenic
944298263 2:198092164-198092186 TGAGGTTGGGAGAGGCAAATGGG - Intronic
944548996 2:200828366-200828388 TGTGGGAGGGACTGGCAAATTGG + Intergenic
945020280 2:205564075-205564097 TGAGACTGGGAGATGCAAACAGG + Intronic
945397535 2:209338358-209338380 TGAGAGTGGTAGTGGCAGATAGG - Intergenic
946010863 2:216562502-216562524 TGGGGCTGGGAGTGGGAACCGGG + Intronic
947353271 2:229268751-229268773 AGAGCCTGGGAGTGGCAAAGTGG + Intronic
948042182 2:234911453-234911475 TGAGGCTGGGAGTGAGTCATGGG - Intergenic
948679766 2:239625875-239625897 TGAGGCTGGGAGAGGAGAAGAGG - Intergenic
948769984 2:240246773-240246795 TGAAGCTGGGCGTGGTGAATGGG + Intergenic
949064271 2:241980108-241980130 CGAGGCTGGGAGTGGGGGATGGG - Intergenic
1170598844 20:17825408-17825430 TCCGGCTGGGTGTGGCCAATGGG - Intergenic
1172125085 20:32621044-32621066 TGAGGCTGGGGGTGGGATAGTGG + Intergenic
1172177651 20:32982360-32982382 TGAGCCTGGGAGGGGCATGTGGG + Intergenic
1172424289 20:34844903-34844925 TGAGGCTGGGAATGGGAGAAAGG + Exonic
1172634436 20:36400658-36400680 TGAGGCTGGGGGTGGGGAAGAGG + Intronic
1175069823 20:56323984-56324006 TCCAGCTGGGAGTGGCCAATGGG + Intergenic
1175348578 20:58301411-58301433 TGAGCCCGGGAGTGGGGAATAGG - Intergenic
1176113949 20:63422984-63423006 TGAGGCTGGGAGTGGCTGTGGGG - Intronic
1179579159 21:42329220-42329242 TGAGGCTGGGAGTGGCACATGGG + Intergenic
1180189845 21:46157623-46157645 GGAGGCTGGGAGTGGGGGATGGG + Intergenic
1180253898 21:46609198-46609220 TGAGGCTGGAAGTTTCAAATGGG + Intergenic
1180831577 22:18909661-18909683 AGGGGCTGGGAGCTGCAAATGGG + Intronic
1181885540 22:26019226-26019248 TGAGGCTAAGACAGGCAAATGGG - Intronic
1182737450 22:32541150-32541172 TGAGGCTGGGAGGTGCAGAACGG - Intronic
1183422792 22:37721936-37721958 TGAGGCTAGGAGTTGCAAAGAGG + Intronic
1183960755 22:41410538-41410560 AGGGGCTGGGAGTGGCAGAGGGG + Intergenic
1184334357 22:43844692-43844714 TGAGGCTGGGAGGAGCATACAGG - Intronic
1185195126 22:49464579-49464601 TGGGGGTGGGATTGGCAAAAAGG - Intronic
1185263164 22:49882190-49882212 GGACACAGGGAGTGGCAAATGGG - Intronic
1203281661 22_KI270734v1_random:134932-134954 AGGGGCTGGGAGCTGCAAATGGG + Intergenic
954683178 3:52356789-52356811 TGAGGGTGGGAGGGGCAGCTGGG + Intronic
954998699 3:54906321-54906343 TGTGGTTGGCAGTGGCAAAGGGG + Intronic
955928378 3:64030557-64030579 TGAGGCTGGGAGTTCCAGACCGG - Intergenic
956041837 3:65152902-65152924 GGAGGGTGGGAGTGGGAAATGGG + Intergenic
956197316 3:66665877-66665899 TTGGGCTGGGGGTGGAAAATTGG + Intergenic
957319448 3:78610414-78610436 TGAGCCTGGGATTGGCAACAAGG + Intronic
957923366 3:86776253-86776275 TCAGGCTAGGAGTGACAAGTTGG + Intergenic
958520705 3:95182704-95182726 TAAGGCACAGAGTGGCAAATTGG - Intergenic
959355475 3:105322570-105322592 TGAGGATGGGAGTGGGGATTAGG - Intergenic
960356220 3:116656474-116656496 TAAGGCAGGGAGTGGTAAGTGGG + Intronic
960376569 3:116909621-116909643 TGAGGATATGAGTAGCAAATTGG + Intronic
961872141 3:129996328-129996350 AGAGGGTGTGAGGGGCAAATGGG + Intergenic
962467017 3:135670040-135670062 TGAGGCTGGGAGTGGGAGGAGGG - Intergenic
964397472 3:156260425-156260447 TGGGGCTGGGAGTGGGAACAGGG - Intronic
964747025 3:160022197-160022219 GGAGGCTGGGAGTGGGCAGTGGG - Intronic
965026045 3:163303308-163303330 TGTTGCTGGGAGTGGGAAAGAGG - Intergenic
966928326 3:184659846-184659868 CGAGGCTGGGAGTGGCCATGGGG - Intronic
967427380 3:189342721-189342743 TGAGGCTGGAAGAGTTAAATTGG - Intergenic
967748414 3:193085742-193085764 TGGGGCTGGGAGTGGGAATAGGG - Intergenic
967881891 3:194307375-194307397 TGAGGATGGGAGTGGCACACAGG - Intergenic
968110211 3:196039797-196039819 AAAGGCTGGGATTGGCAGATTGG - Intronic
968472692 4:789306-789328 TGAGGATGGGAGTGGCTGCTGGG + Intronic
968605376 4:1532739-1532761 TGAGGCTGTGAATTGCTAATGGG - Intergenic
969718577 4:8880510-8880532 TGAGGCTCGGAGAGGCCAAGTGG - Intergenic
969901734 4:10356299-10356321 GGGGGCTGAGGGTGGCAAATGGG - Intergenic
971137154 4:23881805-23881827 TGAGGCAGGGCTTTGCAAATTGG + Intronic
971361624 4:25943348-25943370 TGAGGCTGGGAAAGGCCAAGGGG + Intergenic
972116874 4:35647100-35647122 TAAGGCAGGGAGTGCCAGATAGG - Intergenic
973074714 4:45908617-45908639 TGAGGCTGGAAAGGGTAAATGGG + Intergenic
973535288 4:51875645-51875667 TGGGGCTGGGAGTGGCTGAATGG - Intronic
974176681 4:58333757-58333779 AGAGGCTGGGAGAGGGACATCGG + Intergenic
975553579 4:75637965-75637987 TGAGTCAAGGAGTGGCAAAGTGG - Intergenic
976364143 4:84214331-84214353 TGAGGCAAGGAGTAGCAAAGTGG + Intergenic
977224008 4:94373215-94373237 GGAGGGTGGGAGAGGAAAATTGG - Intergenic
978170164 4:105660231-105660253 TGGGGATGAGAGTGGCGAATGGG - Intronic
979529676 4:121756338-121756360 GGAGGCAGGGAGAGACAAATAGG + Intergenic
980929615 4:139173109-139173131 TGAGGCTGGGGGTGGGAATAAGG + Intronic
982001580 4:151025715-151025737 TGAGTCTGGGAACGGCAAGTAGG + Intergenic
982699604 4:158644691-158644713 TGTGGGTGAGAGTAGCAAATAGG - Intronic
983583866 4:169335561-169335583 TGGGGCTGGGAGTGGGAGATCGG + Intergenic
983621210 4:169762876-169762898 AGAGGCTGGGGGTTGGAAATGGG - Intergenic
983821486 4:172198770-172198792 TGATGCTGGGAGAGGCAAGTAGG - Intronic
984678079 4:182572891-182572913 TCAGGCTGGCAGTGGCAGTTGGG + Intronic
985590552 5:762267-762289 TGAGGCTGTGAGTGGCCATCTGG - Intronic
985968042 5:3352589-3352611 TGAGGCTAGGAGTGGCCACCAGG + Intergenic
988765297 5:34367072-34367094 AGAGGCTAGGAGAGGCACATGGG + Intergenic
988879234 5:35482435-35482457 TGAGGCTGGGAGGAGAAAAAAGG - Intergenic
989343773 5:40406774-40406796 TGAGGCTGGGACTGGAGAACTGG - Intergenic
989408258 5:41086672-41086694 GGAGTCTGGGAATGGCAAAGTGG - Intergenic
991371450 5:65925088-65925110 TGGCGCTGGGAGTGGGAAAAGGG - Intergenic
992159565 5:73987638-73987660 TCAAGCTCGGAGTGGCAAAAAGG + Intergenic
993007158 5:82441034-82441056 TGAGGCTAGGTATGGCCAATGGG + Intergenic
993493756 5:88584663-88584685 TGAAGATAGGAGTGGGAAATGGG - Intergenic
995258965 5:110079313-110079335 TGTGGGTGGGAGTGGAAAATAGG + Intergenic
998151638 5:139760683-139760705 GGAGGAGGGTAGTGGCAAATGGG + Intergenic
998601285 5:143587866-143587888 TAAGGTTGGGAGTGGGGAATGGG + Intergenic
998886502 5:146700236-146700258 AGAGGCAGGCAGTGGCAGATGGG + Intronic
999486706 5:152004283-152004305 AGACGGTGGGAGTGGCAGATGGG - Intergenic
999712629 5:154332081-154332103 TGAGGCTGGGAGAGGAGACTGGG - Intronic
1001219128 5:169884046-169884068 AGAGGCTGGGAATGGCCAACAGG - Exonic
1001711056 5:173778269-173778291 TGAGGCCGGGAGTTGCAAAGAGG - Intergenic
1003172579 6:3731871-3731893 TGAGACCTGGAGTGGCATATGGG + Intronic
1003461248 6:6330731-6330753 TGAGGCTTGGAGAGGCAAAGGGG + Intergenic
1003811526 6:9788368-9788390 AGAGGCTAGGAGTGGGAAAATGG + Intronic
1004871344 6:19907631-19907653 TGAGACTGGAATTGGAAAATTGG - Intergenic
1006097721 6:31666242-31666264 TGTCGCTGGGAGCGGCACATGGG + Exonic
1006342380 6:33453597-33453619 TGGGGCTGGGAGTGGAGAAAAGG - Exonic
1006829043 6:36957931-36957953 GGAGACTGGGAGTGGGAAAGGGG - Intronic
1008879572 6:56367369-56367391 TTAGTCTGGGAGTGGGCAATTGG + Intronic
1010652047 6:78467243-78467265 TCAGGCTGGGAGTGGTAGACCGG - Intergenic
1010814486 6:80341420-80341442 TGAGGCTGGGAATGACAAGGAGG - Intronic
1012128951 6:95466999-95467021 TGAGGCTGGCAGTGGCAACTGGG - Intergenic
1012977320 6:105794254-105794276 TGAGCCTGTGAATGGCAAAGGGG + Intergenic
1013757824 6:113481853-113481875 TGAGGTGGAGTGTGGCAAATTGG + Intergenic
1015499593 6:133918733-133918755 TGAGGCTGGAAGTGGGAAAAGGG - Intergenic
1016780249 6:147950340-147950362 TGAGGCTGGGGGCTGCAGATAGG - Intergenic
1017491142 6:154946219-154946241 AGAGGCTGGGAGTGGGGAAGGGG - Intronic
1019195626 6:170280914-170280936 TGCAGCTGGGAGTGGCCCATGGG - Intergenic
1019481421 7:1268609-1268631 TGAGGCTGGGAGCGGGAATGTGG + Intergenic
1019817531 7:3212054-3212076 TGAGGCAAGGAGTGGGAATTTGG + Intergenic
1019904730 7:4053236-4053258 TGAGGCTGGGAGTCCAAAAACGG - Intronic
1020127555 7:5541483-5541505 TGAGGTTTGGAGTGGCCAGTGGG + Intronic
1020411281 7:7894592-7894614 TTAGTCTTGGAATGGCAAATAGG - Intronic
1022629242 7:32070243-32070265 TAAGGATGGGAGCGGGAAATGGG + Intronic
1023004515 7:35848896-35848918 TGAGGCTGGGAGGCGCTAAGAGG - Intronic
1023906219 7:44523474-44523496 TGAGGCTGGGAGTGGCAAATGGG - Intronic
1024557666 7:50617446-50617468 GGAAGCTGGGAGTGGGGAATGGG - Intronic
1026737185 7:72956415-72956437 TGAGGCAGGGAGAGACCAATGGG + Intergenic
1026787384 7:73310397-73310419 TGAGGCAGGGAGAGACCAATGGG + Intergenic
1027106547 7:75408653-75408675 TGAGGCAGGGAGAGACCAATGGG - Intronic
1027701110 7:81471242-81471264 TGTGGCTGGAATTGGCCAATTGG - Intergenic
1029520982 7:101062127-101062149 TGAGGCTGGGATTAGAAAACAGG + Intergenic
1032300356 7:130680751-130680773 TGAGGATTGGGGTGGCAAAGTGG - Intronic
1032487442 7:132298391-132298413 TCAGGATGGGAGTGGCAGAGAGG + Intronic
1032783599 7:135183721-135183743 TGAGGCTGGGACTGGGAAAGAGG + Intergenic
1033087678 7:138357390-138357412 GGAGGCAGGGAGGGGCAAAAAGG - Intergenic
1033429175 7:141273213-141273235 AGAGGCTGGGAGTGGGAGAATGG + Intronic
1033448480 7:141441935-141441957 GGAGGCCGGGGGTGGCAAGTGGG + Intronic
1034613725 7:152396086-152396108 TGAGGCTGGGATTTGAACATAGG + Intronic
1035769522 8:2135943-2135965 TGAAGCTGGGAGTGGGAAGCTGG + Intronic
1036777128 8:11621122-11621144 TGAAGCAGAGAGAGGCAAATTGG - Intergenic
1037434940 8:18852601-18852623 GGGGGCTGGGAGAGGAAAATGGG - Intronic
1038413316 8:27375091-27375113 TGAGGCTGGAAGGGGCTGATGGG + Intronic
1039271023 8:35880615-35880637 TGAGGTTGGGAGTGAAAACTGGG - Intergenic
1039674996 8:39653013-39653035 AGGGGCTGGGAGTGGGAAACTGG + Intronic
1039905627 8:41784264-41784286 GGAGGCTAGGAGTGGAGAATGGG - Intronic
1040933217 8:52756639-52756661 TGAGAGTGGCAGTGGCAAGTTGG - Intergenic
1041197018 8:55410640-55410662 AGAGGCAGGCAGGGGCAAATGGG - Intronic
1041397534 8:57406860-57406882 TGAGGCTGGGAAGGGCAAGTAGG + Intergenic
1041486335 8:58381576-58381598 GGAGGCTGGGAAAGGCGAATTGG - Intergenic
1042185549 8:66133115-66133137 TGGGGTTGGGACTGGCAAGTTGG - Intronic
1043182652 8:77105574-77105596 TCATGCTGGGAGTTGCAAACTGG - Intergenic
1043201586 8:77375926-77375948 TGGGGCTGGAAGTGGGAAATAGG - Intergenic
1044367068 8:91360315-91360337 TGGGACTGTGAGTGCCAAATAGG + Intronic
1045587814 8:103559129-103559151 TGAGGCTGCTGGGGGCAAATGGG - Intronic
1046720170 8:117610332-117610354 GGAGGCCGGGAGTGGCAGCTTGG - Intergenic
1047523786 8:125615585-125615607 GGAGGCTGGGGGAGGCAAAATGG - Intergenic
1047678723 8:127231471-127231493 TTAGGTTGGGTGTGTCAAATAGG - Intergenic
1047897066 8:129378008-129378030 TGAGGTTGGGATTGGGAACTAGG - Intergenic
1047946004 8:129881193-129881215 TGAGGATGAAAGTGGGAAATGGG + Intronic
1048525033 8:135194635-135194657 TAAGGCAGGGAGTGGCCAATGGG - Intergenic
1048802676 8:138208155-138208177 TGAGGTTGGGGGTGGCACACAGG + Intronic
1050296656 9:4212006-4212028 TGGGGCTGGGAGTGGGAAAGAGG + Intronic
1050635400 9:7607067-7607089 TGATCCTGGGTGTGGCACATTGG + Intergenic
1052839587 9:33280506-33280528 GGAGGCTGGGAGAGTCAAAAAGG - Intronic
1053396382 9:37778081-37778103 AGAGGGTGGCAGTGGCACATAGG + Exonic
1054152922 9:61619792-61619814 TGAGACAGGGAGTGGCAAGCAGG + Intergenic
1054882156 9:70155269-70155291 TGAGGCAGGGAGGGTCAAGTTGG - Intronic
1055387637 9:75780489-75780511 AGAGGCTGGGAAGGGCAATTGGG + Intergenic
1056692975 9:88823773-88823795 TGAGAGTGGGAGTGGCAAGGTGG + Intergenic
1057442455 9:95091920-95091942 TGGGGCTGGGGGTGGGAAAAGGG + Intergenic
1058947640 9:109873788-109873810 AGAGGCTGGGTGGGGCAGATTGG - Intronic
1059520615 9:114938065-114938087 TGAGACTTGGAGTGGCAAAATGG + Intergenic
1059566540 9:115388164-115388186 TGAAGCTGGGAGTGGGAATGGGG + Intronic
1061035181 9:128109528-128109550 TGAGGCTGGGAGGGGCAGCTGGG - Intergenic
1061624159 9:131831403-131831425 TGAGGCTGGGAGGGAAGAATGGG + Intergenic
1061978417 9:134085503-134085525 TGCAGCTGGGAGTGGCCAATAGG + Intergenic
1062431297 9:136527926-136527948 GGAGGGTGGGAGTGGCACAGTGG - Intronic
1185758602 X:2672324-2672346 AGGGGCTGGGAGAGGCAAAAAGG + Intergenic
1186136830 X:6530073-6530095 TGAAGCTGGGAATGACCAATAGG + Intergenic
1186267512 X:7848357-7848379 TGAAGCTGGGAATGACCAATAGG - Intergenic
1186297533 X:8166512-8166534 TGAAGCTGGGAATGACCAATAGG + Intergenic
1186376668 X:9010747-9010769 TGAAGCTGGGAATGACCAATAGG - Intergenic
1187022870 X:15402671-15402693 TGAGGCTGGGAATGGTAGTTGGG - Intronic
1187088117 X:16063262-16063284 TCAGGCTAGGAGTGGGAAACTGG + Intergenic
1187131185 X:16504483-16504505 AGAGGCTGGGAATGGCAACGGGG - Intergenic
1187923407 X:24228101-24228123 AGAGGCTGGGAATGGGAAGTGGG + Intergenic
1190298598 X:49043075-49043097 TGGGGCTGGGAGTGCCGACTGGG - Intronic
1192261961 X:69510921-69510943 TAAGACTGGGAGTGGGAAAGTGG + Intronic
1192507554 X:71698191-71698213 TGATGCTGGAAGTAGCAAATGGG - Intergenic
1192519142 X:71783361-71783383 TGATGCTGGAAGTAGCAAATGGG + Intergenic
1194861220 X:99000993-99001015 TTCTGCTGGGAGTGGAAAATGGG + Intergenic
1195036634 X:100975968-100975990 TGAGGCTTGGAGCTGCTAATGGG - Intronic
1195144797 X:102002274-102002296 AGAGGCATAGAGTGGCAAATTGG + Intergenic
1195560889 X:106282484-106282506 GGAGGCTGAAAGAGGCAAATAGG + Intergenic
1195610824 X:106864184-106864206 GGAGGATGAGAGTGGCAAGTAGG + Intronic
1195883411 X:109616191-109616213 ATAGGGTGGGAGTGGCAAAAAGG + Intergenic
1196698690 X:118642314-118642336 TGAGGCTGGGAATGAGAAAGGGG + Intronic
1198513044 X:137373517-137373539 TGAGGCTCAGAGTGGGCAATTGG + Intergenic
1201629631 Y:16055956-16055978 GGAGGATGGGAGTGGGACATGGG - Intergenic