ID: 1023906220

View in Genome Browser
Species Human (GRCh38)
Location 7:44523475-44523497
Sequence TTGAGGCTGGGAGTGGCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 410}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023906220_1023906227 28 Left 1023906220 7:44523475-44523497 CCATTTGCCACTCCCAGCCTCAA 0: 1
1: 0
2: 4
3: 39
4: 410
Right 1023906227 7:44523526-44523548 GCAGCTTGTACACAGCTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023906220 Original CRISPR TTGAGGCTGGGAGTGGCAAA TGG (reversed) Intronic
900835186 1:4997809-4997831 TTGAGGGTGGAAGGGGCAGAAGG - Intergenic
901236519 1:7670242-7670264 TTGGGGCTGGGAGTGGAACGGGG - Intronic
901362264 1:8712005-8712027 CTGATGCTGAGACTGGCAAATGG - Intronic
901634983 1:10666354-10666376 TTGGGGAAGGGAGTGGCAACAGG - Intronic
901746327 1:11376118-11376140 TGGAGGCTCAGATTGGCAAAGGG + Intergenic
901944064 1:12686663-12686685 TTGGGGGTGGGAGTGTGAAATGG + Intergenic
902032752 1:13434666-13434688 AAGAGGGTGGGGGTGGCAAAGGG - Intergenic
902681845 1:18049157-18049179 GGGTGGCTGGGAGTGGAAAATGG + Intergenic
903642043 1:24866920-24866942 TTGAGGCTCGGAGGGGTGAAGGG - Intergenic
903653615 1:24935499-24935521 TTGAGGATGGGAGAGAGAAAGGG + Intronic
903687051 1:25139490-25139512 TTGCGGAAGGGGGTGGCAAATGG - Intergenic
903689543 1:25162678-25162700 TTGCTGATGGGAGTGCCAAATGG + Intergenic
904076499 1:27846792-27846814 CTGAGGCTTGGAGGAGCAAAGGG - Intronic
904410894 1:30324270-30324292 GTGAGGCTGGGAGAGGAGAAGGG - Intergenic
904939618 1:34156295-34156317 TTGAGGCTGGGGTAGGGAAAGGG + Intronic
905259578 1:36707989-36708011 TTGAGGCAGGGAGAGCCAAAGGG - Intergenic
905504336 1:38465275-38465297 TTGAGGGTGGAAATGGCAAATGG + Intergenic
905539352 1:38747678-38747700 TTCAGGATGGGAGGGGCAGAAGG + Intergenic
906204784 1:43980966-43980988 TTGAGTCTGTGAGTGTGAAAGGG + Intronic
906713027 1:47945990-47946012 TTGTGGCTGGGAATGCAAAATGG - Intronic
906718832 1:47990853-47990875 TTGAGGCTGGGACTGACACCTGG + Intronic
908962431 1:69714136-69714158 GTGTGTCTGGGAGTGGCAGAAGG - Intronic
909332786 1:74434372-74434394 ATGAGGCTGGAAGAGACAAAGGG - Intronic
909557730 1:76972768-76972790 TTGATGATGGGAGTGCAAAATGG - Intronic
910605448 1:89078741-89078763 TAGAGGCTGGGAAAGGCAGAGGG + Intergenic
910938450 1:92506694-92506716 TTGCTGCTGGGAGTGGAAAATGG - Intergenic
911895683 1:103431754-103431776 TTGCTGCTGGGAGTGTAAAATGG + Intergenic
915225769 1:154410211-154410233 TTGAGGGCTGGAGTGGCAAGGGG + Intronic
915271138 1:154754357-154754379 ATGGGGCTGGGAGTGGCATAAGG + Intronic
917052696 1:170941626-170941648 TTCAGGGTGGCAGGGGCAAAGGG - Intronic
917282646 1:173393439-173393461 CATAGGCTGGAAGTGGCAAAGGG - Intergenic
917653906 1:177106909-177106931 TTGAGGCTTGGAGAAGCACATGG + Intronic
917965770 1:180177630-180177652 CTGAGGGTGGGAGTGGGGAAAGG + Intronic
918042892 1:180923939-180923961 GTGGGGCTGGGAGTGGTAAGGGG - Intronic
918355045 1:183700102-183700124 TTGAGGGTAGGAGTGGGAAGAGG - Intronic
918494997 1:185125567-185125589 TTGAGGCTGGGAAGGGGAGAAGG + Intronic
919620042 1:199854219-199854241 TTGCTGCTGGGAATGTCAAATGG - Intergenic
919775433 1:201191291-201191313 TTGAGGCAGGAAGAGCCAAATGG - Intronic
919797107 1:201327475-201327497 TTGAAGATGGGCTTGGCAAATGG + Intronic
920541586 1:206782762-206782784 TAGAGGCTGGGTGTGGTCAAGGG + Intergenic
920594208 1:207252237-207252259 GTGGGGGTGGGAGTGGGAAATGG - Intergenic
921186877 1:212678042-212678064 TGGAGGCTGGAAGGGGCAGAGGG + Intergenic
921411402 1:214839986-214840008 GTGAGGGAGGGAGTGGGAAAAGG - Intergenic
922170257 1:223148609-223148631 TTCAAGGTGGGAGTGGCCAATGG + Intergenic
922675632 1:227547310-227547332 TTGGTGATGGGGGTGGCAAAGGG + Intergenic
922714443 1:227859621-227859643 CTGAGATTGGCAGTGGCAAAAGG + Intergenic
923864340 1:237923043-237923065 TTGATGGTGGGGGTGTCAAATGG - Intergenic
924549314 1:245060120-245060142 TGGAGTCTGGGGATGGCAAAGGG + Intronic
1063966718 10:11351790-11351812 TTGGGGGTGGGGGGGGCAAAGGG + Intergenic
1067444154 10:46330048-46330070 CTGAGGGGGGGAGTGACAAAGGG - Exonic
1070166290 10:73900707-73900729 GTGAGGTTGGGATTGGCAGAGGG - Intergenic
1070292057 10:75123569-75123591 GTGAGGGTGGGAGTGGAAATGGG + Intronic
1070776785 10:79114400-79114422 TGGAGGCTGGGAGTGGGGGAAGG + Intronic
1070935633 10:80292724-80292746 TTGGGGCTTGGAGTGGCCATTGG - Intergenic
1071049782 10:81432370-81432392 TTAATGCTGGGAATGGAAAATGG - Intergenic
1071096182 10:81978180-81978202 TAGAGGCTGGGAGGGGTAAGGGG - Intronic
1071718563 10:88120467-88120489 TTGAGGCTGGAAGAGGCTCAGGG + Intergenic
1073208375 10:101780438-101780460 TAGAGGCTGGGAGTGGGAGTTGG + Intergenic
1073434558 10:103508384-103508406 CTGAGGATGAGAGTCGCAAATGG - Intronic
1074453235 10:113576224-113576246 TTGAGGCTGAGAGGGGATAAGGG + Intronic
1075194033 10:120339206-120339228 CTGGGGCTGGGAGTTGAAAAAGG + Intergenic
1075269802 10:121038784-121038806 GGGAGGCTGTGAGTGCCAAAAGG - Intergenic
1075307051 10:121377487-121377509 TTGGGGCTGGGAGAGGGAAAGGG - Intergenic
1075671955 10:124268982-124269004 TTGGAGATGGGAGTGGCAATGGG - Intergenic
1075851537 10:125592244-125592266 GCGAGGCTGGGGGTGGCAAGTGG + Intronic
1075891825 10:125958203-125958225 TAGAGGCTGGGAAGGGTAAAGGG - Intronic
1076550661 10:131275936-131275958 GTGAGTCTGGGGGAGGCAAAGGG - Intronic
1076614980 10:131749215-131749237 CTGAAGCTGGGAGTGGGAAGGGG - Intergenic
1076835087 10:133016946-133016968 TTGAGCCTTGGAGGGGCCAAGGG - Intergenic
1078666707 11:13331826-13331848 CTGAGGCTGGAAGGGGCAGAGGG + Intronic
1079047309 11:17117144-17117166 TAGTGGCTGGGAGGGGAAAATGG + Intronic
1079394503 11:20050233-20050255 TTGGGGTTGGGGGTGGCAAAAGG - Intronic
1081565270 11:44256913-44256935 TGGAGGCTGGGAAGGCCAAAGGG - Intergenic
1083107534 11:60373126-60373148 TTAAGGCTGGCTGTGGCAAGAGG + Intronic
1083277035 11:61602747-61602769 CTGGGGCTGGGTGGGGCAAAAGG + Intergenic
1083369372 11:62166232-62166254 CTGACACAGGGAGTGGCAAAAGG - Intergenic
1083630459 11:64092468-64092490 TTGAGGTTGGGTGTGGCCAGAGG + Intronic
1083964622 11:66035803-66035825 TGGAGGATGGGGGTGGCAGAGGG + Intergenic
1084045391 11:66565045-66565067 TTCTGGCTGTGAATGGCAAATGG - Intronic
1084672741 11:70616711-70616733 TGAAGGCTGGGAGTGCCAGAAGG + Intronic
1085705224 11:78781062-78781084 TTGAAAATGGGAGTGACAAATGG + Intronic
1088323736 11:108580890-108580912 TAGAGGCTGGGAATGGGGAAAGG + Intronic
1089635321 11:119808076-119808098 CTGTGGCAGGGAGTGGCAATAGG + Intergenic
1089696825 11:120221057-120221079 TTGGGGCTGGGGGTGGCATGAGG - Intronic
1089792706 11:120956166-120956188 CTGAGGCTAGGAGTGTCAAGAGG - Intronic
1090083184 11:123628042-123628064 CTGAGGCTTGGAGTGACAGATGG - Intergenic
1091126862 11:133107970-133107992 TTCAGGCTTGGAGTGGCTATTGG + Intronic
1091583779 12:1804656-1804678 TTGCGGCAGGGACTGGCCAATGG + Intronic
1091893407 12:4081369-4081391 TTGAGTATGGGAGTGGCAGTGGG - Intergenic
1092370902 12:7915950-7915972 ATGAGGCTGGGACTGGCGCACGG - Intergenic
1092445074 12:8547977-8547999 TTGTTGCTGGGAGTGTAAAATGG + Intergenic
1093002894 12:14018107-14018129 TTGGGGCTGGGAGTGGGAGAAGG - Intergenic
1093433302 12:19107810-19107832 TTGCGGCTGAGAGTGGCAGCAGG + Intergenic
1095047212 12:37520724-37520746 TTGCTGCTGGGAATGCCAAATGG + Intergenic
1095886081 12:47189968-47189990 GTGGGACTGGGAGTGGCCAAGGG - Intronic
1095975080 12:47934889-47934911 TTCTGGCTGGGAATGGAAAATGG + Intronic
1096225677 12:49865480-49865502 TGGAGGCAGGGGGTGGCAAGGGG + Intergenic
1096899025 12:54855197-54855219 ATGAGGCTGGAAGTGAAAAATGG - Intronic
1097243635 12:57592877-57592899 TTTAGGCTGGGAGTCTCAAGTGG + Intronic
1098482555 12:70982873-70982895 TTGAGGATGAGAGTGGCGACTGG + Intergenic
1100687159 12:96999065-96999087 GTGAGACTGGGAGTTGCAGAAGG + Intergenic
1101697641 12:107141297-107141319 TAGAAGCTGGGAGTGGAAATGGG + Intergenic
1101838593 12:108311991-108312013 ATGAGGCTGGGAGAAGCAAGGGG - Intronic
1101872029 12:108573867-108573889 ATCAGGCTGGGAGTTGCAGAAGG + Intergenic
1102600400 12:114025377-114025399 TCCTAGCTGGGAGTGGCAAAAGG + Intergenic
1103393832 12:120592868-120592890 TTGCGGCTGGGAGTGGAAAATGG - Intergenic
1104085088 12:125467028-125467050 TTGATGCTGGGATGGGCATATGG + Intronic
1105348328 13:19593945-19593967 TAGAGGCTGGGAAGGGCAGAGGG + Intergenic
1105503715 13:20992561-20992583 TTGAGGCTGGCTGTGGGACAAGG + Intronic
1106118371 13:26837022-26837044 TTTATGCTGTGACTGGCAAAGGG + Intergenic
1106769748 13:32950542-32950564 TTGAGGCTGGGAGAGGTGAAGGG + Intergenic
1107480719 13:40783782-40783804 TAGAGGCTGGGAAAGGCAGAGGG + Intergenic
1108623755 13:52208292-52208314 TTGAGGCTGATGGTTGCAAAGGG + Intergenic
1108662961 13:52602739-52602761 TTGAGGCTGATGGTTGCAAAGGG - Intergenic
1110151314 13:72258328-72258350 ATTAGGCTTGGAGGGGCAAAAGG + Intergenic
1110193597 13:72759946-72759968 TTGAAGCTGGCAGTGGGGAAGGG - Intronic
1111091161 13:83449885-83449907 ATGAGGCAGGGAGTGATAAAAGG + Intergenic
1111695271 13:91615433-91615455 TTGAAACTAGGTGTGGCAAAAGG - Intronic
1111991269 13:95119941-95119963 TTGAGGCTGGGGTGGGCATAGGG - Intronic
1112947888 13:104954789-104954811 TTGTGGCTGGTAGTCGAAAAGGG + Intergenic
1113280755 13:108784944-108784966 TTGAAGCTGAGAGGGGCAAGGGG + Intronic
1113649497 13:112026071-112026093 TTGTGGCTGGGAGTGACCAGAGG - Intergenic
1114659615 14:24335894-24335916 TGGGGGCTGGGAGTGGGCAATGG - Intronic
1115588283 14:34837320-34837342 TTGAGACTGGGAGGCGGAAATGG - Intronic
1116632764 14:47355780-47355802 TTGATGCTGGGAGTGGGAATAGG - Intronic
1117160578 14:52985509-52985531 TTGAGGCTGGTGGTGGTAGAAGG + Intergenic
1117346909 14:54841629-54841651 CTGGGGCAGGGAGTGGAAAAGGG - Intergenic
1117486446 14:56202620-56202642 TGGAGTCTGGGAGTGGGGAAGGG + Intronic
1117711374 14:58532394-58532416 TTTAGGATGGGAGTAGCCAATGG + Intronic
1117808921 14:59524610-59524632 TTGCTGGTGGGAGTGGCAATTGG + Intronic
1118778785 14:68992229-68992251 TTGAGGCTGTGAAGGTCAAATGG + Intergenic
1119115982 14:72021922-72021944 TTGAGGGTGGGGGTGGCAGAAGG - Intronic
1119853398 14:77882134-77882156 CTTAGGCTGGGGGTGGGAAAGGG + Intronic
1120465763 14:84855237-84855259 TTGAGGGTGTGAGCAGCAAAGGG + Intergenic
1121573020 14:94961817-94961839 CTGAGGCTTGGGGTGACAAAGGG - Intergenic
1121863339 14:97339666-97339688 TAGAGGCTAGGAGTTGCAAGTGG + Intergenic
1122804666 14:104250364-104250386 GTGAGGGTGGGAGTGTGAAATGG + Intergenic
1122852464 14:104544078-104544100 CTGAGGCTGGGAGAGGATAAGGG + Intronic
1122939225 14:104973801-104973823 GTGAGGGTGGGAGTGGCATCGGG - Intronic
1124148143 15:27150278-27150300 TGGGGAGTGGGAGTGGCAAATGG + Intronic
1124338742 15:28876391-28876413 TGGAGGCTGGGAGTTCCAAATGG - Intergenic
1124853117 15:33360274-33360296 CTGGGGCTGGGAGTGGGAGATGG - Intronic
1124913889 15:33949564-33949586 CTGAGGCTGGGTGTGGGAAGGGG + Intronic
1126659475 15:51018176-51018198 TAGAGGCTGGGAAGGGTAAAGGG - Intergenic
1126929984 15:53637014-53637036 TTAATGGTGGGAGTGGCAATGGG - Intronic
1127260347 15:57322803-57322825 TTGAGGCTGGGAGAGGTAGACGG + Intergenic
1129702769 15:77777148-77777170 TTGAGGCTGGGGCTGGGGAAAGG - Intronic
1130700291 15:86172503-86172525 CAGAGGCTGGGAGTGGGGAAGGG - Intronic
1130718076 15:86356161-86356183 TTGAGGCTGGGAAGGGGTAATGG + Intronic
1130792547 15:87170875-87170897 TGGAGGATGGGAGTGAGAAAAGG - Intergenic
1131552943 15:93373432-93373454 GTGAGGCAGGGAGTGGCAATTGG + Intergenic
1131681039 15:94723750-94723772 ATGAGGCTGGGAGTGTCTAGGGG + Intergenic
1132693823 16:1193344-1193366 AGGAGGCTGGGAGAGGCCAAGGG + Intronic
1132844151 16:1992333-1992355 CTGAGGCAGGGAGTGTCAATGGG + Intronic
1134106504 16:11489193-11489215 CTGAGGCTCGGAGAGGCAGAGGG - Intronic
1134435949 16:14257137-14257159 CTGAGGGTGGGAGTGTAAAATGG + Intronic
1135085707 16:19473024-19473046 GTGAGGCTGGGAGAGGCACTGGG - Intronic
1135290464 16:21233189-21233211 CTGAGGTTGGGAGTGGAAATGGG + Intergenic
1135674350 16:24402631-24402653 CTGAGACTGGGAGTGGGAAGAGG + Intergenic
1136028695 16:27487046-27487068 TTGAGATTGGCAGTGGCATATGG - Intronic
1136157339 16:28392006-28392028 TGAAGGCGGGGAGTGGGAAAGGG - Exonic
1136205747 16:28723275-28723297 TGAAGGCGGGGAGTGGGAAAGGG + Exonic
1137564583 16:49525064-49525086 TTGAGGCTGGGTTGGACAAAGGG + Intronic
1138141924 16:54576109-54576131 TCCAGGCTGGGAGTGGACAAAGG + Intergenic
1138222979 16:55268844-55268866 TTGTGGCTGGGAAGGGCAATAGG - Intergenic
1138436041 16:57000597-57000619 TTGAGGCTCACAGTGGGAAAGGG - Intronic
1139562927 16:67755221-67755243 TTCAGGGTGGGAGTGGGAAAAGG - Intronic
1141227179 16:82129036-82129058 TTAAGGCTGGGGATGGCAGAGGG + Intergenic
1141415667 16:83871043-83871065 TAGGGGCTGGGTGGGGCAAATGG - Intergenic
1141765102 16:86052963-86052985 TCCAGGCTGGGAGGGGCAGAGGG + Intergenic
1141922145 16:87143491-87143513 CTGAGGCTTGGAGTGGGGAAGGG - Intronic
1142192945 16:88726224-88726246 TTGGGGCTGGGAGGGGGCAATGG - Intronic
1142341136 16:89523410-89523432 TTGAGGCAGGTTGTGGTAAAAGG + Intronic
1143255597 17:5555528-5555550 TGGGGGCTGGGATAGGCAAAGGG - Intronic
1143332631 17:6148884-6148906 AGGAGGCTGGGGGTGGCAAGAGG - Intergenic
1143773467 17:9182774-9182796 TTGAGCCAAGGAGTGGGAAACGG + Intronic
1143871848 17:9962636-9962658 TTGAGGCTGGGGTTTGCAAATGG - Intronic
1144179400 17:12737642-12737664 GTGAGGCCAGGAGTGGTAAAGGG - Intronic
1145435816 17:23034075-23034097 TTGAGGCTTGTGGTGGAAAAGGG + Intergenic
1146272750 17:31495100-31495122 TGGGGGCTGGCAGTGGCAGATGG - Intronic
1146316424 17:31810764-31810786 TTGAGGCTGAGAGAGGGTAAGGG - Intergenic
1147420929 17:40321875-40321897 TTGACACTTGGAGTGGCGAAGGG - Intronic
1147422947 17:40331596-40331618 TTGAAGTTGGGGGTGGCAGAGGG + Intronic
1147782839 17:42956123-42956145 ATGGGGCTGGGAGTGGGAGAGGG - Intronic
1147844965 17:43398762-43398784 TGGAGGGTGGGAGGGGCGAAAGG - Intergenic
1148482651 17:47970256-47970278 TTGAGGCAGCGAGTGGCTAGAGG - Intronic
1148643660 17:49206597-49206619 TTGAAGGTGGGAGTGGGGAATGG + Exonic
1150386011 17:64760958-64760980 GAGAGGCTGGGAGGGGCATAAGG - Intergenic
1150631228 17:66881805-66881827 TTGGGGGTGGGGGTGGAAAATGG + Intronic
1151367077 17:73624410-73624432 TTGAATCCGGGAGTGGCAGATGG + Intronic
1151518594 17:74613046-74613068 TGGAGGCTGTGAGTGGGACAGGG - Intronic
1152296172 17:79468130-79468152 TTCAGGGTGGGAAGGGCAAATGG - Intronic
1152326867 17:79646734-79646756 TTGGGGTTGGGGGTAGCAAATGG - Intergenic
1153642165 18:7166415-7166437 TGGAGGCTGTAAGTGGCAAGAGG - Intergenic
1153919884 18:9779071-9779093 TTGAGCGTGGGAGAGGCAGAAGG + Intronic
1155491966 18:26408455-26408477 TTGAGGATGGGCCTGGTAAATGG - Intergenic
1155719499 18:28993208-28993230 TGGTGGCTGGGAGGGGCAAGTGG + Intergenic
1155928319 18:31680841-31680863 TTAGGGCTTGGAGTGGCACATGG - Intronic
1156269925 18:35521251-35521273 TTGAGGATAGAAATGGCAAAGGG - Intergenic
1156354992 18:36333072-36333094 TTGAGGCTGCCATTGGCTAAGGG - Intronic
1157339612 18:46767898-46767920 ATGAGGCTGGGAGGAGCACAGGG - Intergenic
1157991699 18:52504296-52504318 TTGAGTCTGGCAGTGTCAATGGG + Intronic
1158321262 18:56267245-56267267 TGGAGTCAGGGAGTGGAAAACGG - Intergenic
1158403714 18:57142964-57142986 TTGTGGTTGGGGGTGGGAAAAGG + Intergenic
1158499490 18:57987320-57987342 GTGAGACTGGGAGGGGCAAAGGG - Intergenic
1160775295 19:852672-852694 CTGAGGCACGGAGAGGCAAAGGG - Intronic
1160817422 19:1042606-1042628 CTGAGGCTCTGAGAGGCAAAGGG - Intronic
1162079719 19:8210666-8210688 TTGAGGCTGGGGGAGGCCGAGGG - Intronic
1163155729 19:15439045-15439067 ATGAGGCTGGGGGTGGCTAGGGG + Intronic
1163687940 19:18722772-18722794 CTGGGGCTGGGAGTGGAAATGGG - Intronic
1163769539 19:19182528-19182550 TTGCAGCTGGGAGTGGCAGTGGG + Intronic
1164327568 19:24211708-24211730 TTGAGGCTGAGAGTGAAAAAAGG - Intergenic
1164535464 19:29083602-29083624 ATGAGTCTGGGAGGGGCACATGG + Intergenic
1165252650 19:34553127-34553149 TTGAGGAAGGGAGTGGGTAAGGG + Intergenic
1165693485 19:37882806-37882828 TTGGGGTGGGGAGTGGCAAATGG + Intergenic
1165820201 19:38670108-38670130 GTGGGGCTGGGAGGGGCATATGG - Intronic
1165885955 19:39078548-39078570 TTGAGGCACAGAGAGGCAAATGG + Intergenic
1167140428 19:47646951-47646973 TGGAGGCTGGGAGGGGGAGAAGG - Intronic
1167477407 19:49709054-49709076 TTGAGGATGGGATTGGCAGTGGG - Intronic
1167925972 19:52821245-52821267 ATGAGGCTGGGAGGCGCACAGGG + Intronic
925599585 2:5594241-5594263 TTGAGGCTGAGATTGTTAAAAGG - Intergenic
926424473 2:12728510-12728532 CTGAGGCAGAGAGTGGCAGAGGG - Intronic
926587565 2:14705174-14705196 TTGGAGCTGGCATTGGCAAAGGG - Intergenic
927193138 2:20530776-20530798 TTGAGGCTGGAAGCTGCACAGGG + Intergenic
927727118 2:25434237-25434259 TTGGGGGTGGGAGTGGCGACTGG - Intronic
927839472 2:26430201-26430223 TTGGGGCAGACAGTGGCAAAGGG + Intronic
927882793 2:26700448-26700470 TTGAGGCTGGCTCTAGCAAATGG - Intronic
927946488 2:27137928-27137950 CTGAGGCTGGGAGGGAGAAAAGG + Exonic
928135044 2:28681698-28681720 TTGGGGCTGGGGGTGGCACAGGG + Intergenic
928220764 2:29401119-29401141 CTGAGGGTGGGAGTAGCTAAAGG - Intronic
929145323 2:38702449-38702471 TGTAGGCTGGGGGTGGGAAAGGG - Intronic
930895856 2:56445027-56445049 TTGGGGATGGCAGTGTCAAAAGG + Intergenic
932501007 2:72182663-72182685 TTGGGGCTGGGAGTGGCGGCAGG - Intronic
932731006 2:74221953-74221975 CTGAGGCTGGGAGGGGTTAAAGG + Intronic
933119495 2:78519127-78519149 TCAAGGCTGGGGGTGGAAAATGG - Intergenic
935626575 2:105176696-105176718 TTGAGGATGGGTGTGGCAAATGG - Intergenic
935828635 2:106976523-106976545 TGGAGGCTGGAAGTAGGAAAGGG - Intergenic
936963055 2:118097052-118097074 CTGAGGCTGGGGGTGGGGAATGG - Intronic
938561456 2:132475863-132475885 ATGAGGATGGGAGTGTGAAATGG - Intronic
938719969 2:134058403-134058425 TTGAGGGTGGGAGTAGGGAAAGG - Intergenic
938946723 2:136219081-136219103 GTGGTGCTGGCAGTGGCAAAAGG + Intergenic
939862939 2:147441168-147441190 TTGAGGGAAGGAGAGGCAAAGGG - Intergenic
940206221 2:151204815-151204837 GTGAGGGTGGGAGTGGTGAATGG - Intergenic
941385852 2:164851225-164851247 TTGGGGTTGGGGGTGGAAAATGG - Intergenic
944298264 2:198092165-198092187 GTGAGGTTGGGAGAGGCAAATGG - Intronic
944592789 2:201233703-201233725 TGGAGGCTGGGTGGAGCAAAAGG + Intronic
944958067 2:204835522-204835544 TTGGGGAAGGGAGTGGCAAACGG - Intronic
945406231 2:209452148-209452170 TTGAGGTTAGGAGTGTGAAAGGG + Intronic
945807147 2:214503459-214503481 TTGAGGAAGAGAGAGGCAAAGGG + Intronic
946010862 2:216562501-216562523 ATGGGGCTGGGAGTGGGAACCGG + Intronic
946604244 2:221385483-221385505 TTGCTGCTGGGAGTGTAAAATGG - Intergenic
948152216 2:235753211-235753233 TTCAGGTTGGGGGTGGCAAGAGG + Intronic
948737534 2:240019005-240019027 GTGAGGCTGGGAGTGGACAGAGG - Intronic
948769983 2:240246772-240246794 TTGAAGCTGGGCGTGGTGAATGG + Intergenic
1168853120 20:990039-990061 CTGAGGCTCGGAGAGGTAAAGGG + Intronic
1169887643 20:10418302-10418324 TTAAAGCTGGTTGTGGCAAAAGG + Intronic
1170474454 20:16701102-16701124 ATGAGGTTTGGAGAGGCAAATGG - Intergenic
1170598845 20:17825409-17825431 TTCCGGCTGGGTGTGGCCAATGG - Intergenic
1171135305 20:22689974-22689996 TTGAGTCTCGCAGTGGCAACCGG + Intergenic
1173065958 20:39711760-39711782 TAGAGGCTGGGAAGGGCACAGGG - Intergenic
1173549782 20:43924562-43924584 TTGAGGCTGGGCAGGGCAGATGG - Intronic
1174303870 20:49601454-49601476 ATAAAGCTGGGAGTGGCAAGGGG - Intergenic
1174394052 20:50235055-50235077 CAGAGGCTGGGAGTAGGAAAGGG - Intergenic
1174632066 20:51966802-51966824 TTGGGGGTGGGAGTGGGAAGTGG - Intergenic
1174885132 20:54325706-54325728 TTGAGGCTGAGGGTGGGAATTGG - Intergenic
1175069822 20:56323983-56324005 TTCCAGCTGGGAGTGGCCAATGG + Intergenic
1175166295 20:57047094-57047116 CTGAGGCTGGGGGTGGTCAACGG - Intergenic
1175511532 20:59530724-59530746 TTGCGGCTGGGAATGCAAAACGG + Intergenic
1175809604 20:61850858-61850880 GTGAGGCAGGGAGTGGGACAAGG + Intronic
1176113950 20:63422985-63423007 CTGAGGCTGGGAGTGGCTGTGGG - Intronic
1178250173 21:30996212-30996234 TTGGGGCAGGGAGTGGGGAACGG + Intergenic
1178369951 21:32019000-32019022 TTGAGGATGGGAGTGTGGAAAGG + Intronic
1179579158 21:42329219-42329241 CTGAGGCTGGGAGTGGCACATGG + Intergenic
1179909057 21:44438433-44438455 TTGAGGGTGGGAGTGTCATGGGG + Intronic
1180189844 21:46157622-46157644 TGGAGGCTGGGAGTGGGGGATGG + Intergenic
1180253897 21:46609197-46609219 ATGAGGCTGGAAGTTTCAAATGG + Intergenic
1180831576 22:18909660-18909682 TAGGGGCTGGGAGCTGCAAATGG + Intronic
1180941662 22:19663612-19663634 ATGTGGCTGGGAGTGGCACGGGG + Intergenic
1182847321 22:33442382-33442404 TTGAGGCAGAGCCTGGCAAATGG - Intronic
1183960754 22:41410537-41410559 CAGGGGCTGGGAGTGGCAGAGGG + Intergenic
1184424617 22:44402258-44402280 ATGAGGCTGGCAGTGGCAGAGGG + Intergenic
1184613905 22:45624892-45624914 TTGAGAGTGGGAGTGGCATCTGG + Intergenic
1203281660 22_KI270734v1_random:134931-134953 TAGGGGCTGGGAGCTGCAAATGG + Intergenic
950533983 3:13569012-13569034 TTTAGGCTGGGAGTCGGAGAAGG + Intronic
950633947 3:14302288-14302310 GTCAGGCTGGGAGGGACAAAGGG - Intergenic
950707571 3:14792562-14792584 TTGAGGCAGAGAGAAGCAAAAGG + Intergenic
950985522 3:17360391-17360413 TTAAGACCGGGATTGGCAAAGGG + Intronic
952093391 3:29919523-29919545 TTGAAACTGGGATTAGCAAATGG - Intronic
953381288 3:42474567-42474589 TTGAGGCTGGGAGAGGCTAAGGG - Intergenic
954706237 3:52482098-52482120 TTGTGGGAGGTAGTGGCAAAAGG + Intronic
954998698 3:54906320-54906342 ATGTGGTTGGCAGTGGCAAAGGG + Intronic
955311224 3:57888657-57888679 TTGAGGATGGTAGTAGAAAATGG + Intronic
956041836 3:65152901-65152923 AGGAGGGTGGGAGTGGGAAATGG + Intergenic
957314629 3:78561631-78561653 TAGAGGCTGGGAAGGGAAAAGGG - Intergenic
957932173 3:86894613-86894635 TTGAGACTGTGAATGCCAAAAGG - Intergenic
958211045 3:90476192-90476214 TTGAGGCCTGCAGTGGAAAAGGG - Intergenic
958842697 3:99227366-99227388 CTGAGCTGGGGAGTGGCAAATGG + Intergenic
960356219 3:116656473-116656495 TTAAGGCAGGGAGTGGTAAGTGG + Intronic
961823542 3:129587249-129587271 CTGAGGCTGGGAGCGGCCGAGGG + Intronic
962467018 3:135670041-135670063 GTGAGGCTGGGAGTGGGAGGAGG - Intergenic
962859001 3:139379749-139379771 GTGAGGCTGGGAGTAGCCAAAGG - Intronic
963026934 3:140929179-140929201 TTGCTGCTGGGAGTGTAAAATGG - Intergenic
964397473 3:156260426-156260448 CTGGGGCTGGGAGTGGGAACAGG - Intronic
966928327 3:184659847-184659869 CCGAGGCTGGGAGTGGCCATGGG - Intronic
967370709 3:188742643-188742665 CTGAGGCTGGGAGTGGGGAAAGG + Intronic
967748415 3:193085743-193085765 TTGGGGCTGGGAGTGGGAATAGG - Intergenic
968296371 3:197579449-197579471 TTGGAGGTGGGAGTGGCAGAAGG + Intergenic
968446251 4:653804-653826 GTGAGGGTGGGAGTGGCCACAGG + Intronic
968605377 4:1532740-1532762 TTGAGGCTGTGAATTGCTAATGG - Intergenic
970472041 4:16388729-16388751 CAGAGGCTGGGGGTGGCACATGG - Intergenic
971361623 4:25943347-25943369 CTGAGGCTGGGAAAGGCCAAGGG + Intergenic
971665309 4:29475954-29475976 TTGAGGCTGGGAAGGGTAATGGG + Intergenic
976350806 4:84057607-84057629 TGGTGGTTGGGGGTGGCAAAAGG - Intergenic
978229980 4:106386179-106386201 GTCAGGCGTGGAGTGGCAAATGG - Intergenic
979436814 4:120703005-120703027 TTGAGGCTGGGAATGGGCATGGG - Intronic
980950207 4:139368046-139368068 TGGAGCCAGGGAGTTGCAAAAGG - Intronic
981142222 4:141282241-141282263 TTGAGACTGGGAGAGCCCAAGGG - Intergenic
981555670 4:145990948-145990970 TTGAGGGTGGAGGTGGCAGATGG + Intergenic
982292103 4:153790892-153790914 TTGGGCCTGGGAGTGGGATAAGG + Intergenic
982677649 4:158394638-158394660 TAGAGGCTGGGAATGGCAGAGGG - Intronic
985085320 4:186307314-186307336 TAGAGGCAGGGAGTGGCCAAAGG - Intergenic
985672467 5:1213624-1213646 TTGAGGCTGGCGGGGGCACAGGG - Intronic
985732253 5:1555971-1555993 TTGAGGCTGAGAGAGGCCACTGG + Intergenic
986646178 5:9918425-9918447 CAGAGGCTGGTAGTGGCAAAGGG - Intergenic
987072269 5:14349863-14349885 TGGAGGCTGGGAGGAGGAAAAGG - Intronic
989730331 5:44641104-44641126 GTGAGGCACGGAGTGGCAAGGGG + Intergenic
990216243 5:53535585-53535607 TTGCTGCTGGGAATGCCAAATGG - Intergenic
990336320 5:54776225-54776247 TGGAGCATGGGAGTGGTAAAAGG - Intergenic
991371451 5:65925089-65925111 CTGGCGCTGGGAGTGGGAAAAGG - Intergenic
992337677 5:75789546-75789568 TAGAGGCTGGGAATGGCAGTGGG + Intergenic
993007157 5:82441033-82441055 TTGAGGCTAGGTATGGCCAATGG + Intergenic
994331940 5:98516523-98516545 TAGAGGCTGGGAAGGGTAAAGGG - Intergenic
997259613 5:132455853-132455875 TGGAGGCTGGGAGGGGAAATGGG + Intronic
997842370 5:137253741-137253763 TAGAGGGTGGGAGTTGCAAAGGG - Intronic
998151637 5:139760682-139760704 TGGAGGAGGGTAGTGGCAAATGG + Intergenic
998905944 5:146905187-146905209 TTGCTGGTGGGAGTGGAAAATGG + Intronic
999127085 5:149253796-149253818 GAGAGGCAGGGAGTGGCAACAGG - Intronic
999793564 5:154966318-154966340 TTCAGACTGGGAGTGTCAAGAGG - Intronic
999844899 5:155468904-155468926 TTGAGGCTCTGATTAGCAAAGGG - Intergenic
999938148 5:156510748-156510770 ATGAGACTGGAAGTGGTAAAAGG + Intronic
1000832168 5:166116428-166116450 TTGTGGGTGGGAATGGAAAATGG - Intergenic
1003190791 6:3872526-3872548 TGGAGGCTTGGCGAGGCAAAAGG - Intergenic
1003461247 6:6330730-6330752 CTGAGGCTTGGAGAGGCAAAGGG + Intergenic
1003764968 6:9225513-9225535 ATGGGGCTGGGAGTGGAAGAAGG - Intergenic
1003869167 6:10388318-10388340 GTGAGGGTGGGAGTGGGCAATGG - Intergenic
1003969743 6:11287753-11287775 TTGGGGCAGAGAGTAGCAAAAGG + Intronic
1004200129 6:13540631-13540653 TTAGGGTTGGGAGTGGAAAAGGG + Intergenic
1004780396 6:18902241-18902263 TTGGGGCTGGGAGAGTCCAATGG + Intergenic
1005273740 6:24194173-24194195 GTGAGGAGGGGTGTGGCAAATGG + Intronic
1006097720 6:31666241-31666263 TTGTCGCTGGGAGCGGCACATGG + Exonic
1006296161 6:33171023-33171045 TTGTGGCTGGGAGTGGGAGCAGG - Intronic
1006603989 6:35243507-35243529 TTGTGGCGGGGAGTGGGAAGGGG + Intronic
1006829044 6:36957932-36957954 GGGAGACTGGGAGTGGGAAAGGG - Intronic
1008547532 6:52596464-52596486 TTGTGGCTGGGAGGGGCTAGAGG + Intergenic
1009303561 6:62059265-62059287 TTGAAGCTGGGTATGGAAAAAGG + Intronic
1011378272 6:86714643-86714665 TAGAGGCTGGGAATGGTAAGGGG + Intergenic
1011727757 6:90227959-90227981 TAAAGGCTGGGGATGGCAAATGG - Intronic
1011813960 6:91166547-91166569 TGGAGGCTGGAGGGGGCAAATGG - Intergenic
1012128952 6:95467000-95467022 CTGAGGCTGGCAGTGGCAACTGG - Intergenic
1012676457 6:102118909-102118931 TGGAGGTTGAGAGAGGCAAAAGG - Intergenic
1012744015 6:103059597-103059619 TTGAGGTTGGGAGGAGAAAAAGG + Intergenic
1012977319 6:105794253-105794275 GTGAGCCTGTGAATGGCAAAGGG + Intergenic
1012977585 6:105796429-105796451 GAGAGGCTGGGTGTGGCCAAGGG - Intergenic
1013579976 6:111523975-111523997 TTGAGGCAGCTAGTGGCAACTGG - Intergenic
1015499594 6:133918734-133918756 CTGAGGCTGGAAGTGGGAAAAGG - Intergenic
1016016638 6:139193184-139193206 TTGAGACTGGGAGAGGAAGAAGG - Intergenic
1017383863 6:153860901-153860923 GGGAGGCTGGGAGTGGCGTAAGG - Intergenic
1017491143 6:154946220-154946242 CAGAGGCTGGGAGTGGGGAAGGG - Intronic
1020492523 7:8805973-8805995 TTGAAGGAGGGAGTGGTAAAAGG - Intergenic
1020643748 7:10788285-10788307 TTGAAGATGGGAGTGCTAAATGG + Intergenic
1023906220 7:44523475-44523497 TTGAGGCTGGGAGTGGCAAATGG - Intronic
1024486850 7:49929062-49929084 ATGAGGCTTGGAGTGGAAACTGG - Intronic
1026737184 7:72956414-72956436 TTGAGGCAGGGAGAGACCAATGG + Intergenic
1026787383 7:73310396-73310418 TTGAGGCAGGGAGAGACCAATGG + Intergenic
1027047797 7:75002682-75002704 TTGAGGCCAGGAGTGGAAGAGGG + Intronic
1027106548 7:75408654-75408676 TTGAGGCAGGGAGAGACCAATGG - Intronic
1027939444 7:84655709-84655731 CTGAGGCAGGGATTGGCGAAAGG - Intergenic
1028593231 7:92520894-92520916 CTGAGGATGGGACTGGGAAAAGG + Intronic
1029385199 7:100238964-100238986 TTGAGGCCAGGAGTGGAAGAGGG - Intronic
1030285255 7:107819836-107819858 TTGAGAGTGGGAATGGGAAAAGG + Intergenic
1032353833 7:131190811-131190833 TAGAGACTGGTAGTGGAAAATGG + Intronic
1032590257 7:133185472-133185494 TTGATGGTGGGAATGGGAAATGG + Intergenic
1032957636 7:136989938-136989960 TTGAGTCTGGGAGAGGTGAAGGG - Intronic
1033661197 7:143403731-143403753 TTGACCCTAGGATTGGCAAAAGG - Intronic
1034157879 7:148970548-148970570 ATGAGGCTGTGAGCTGCAAAGGG - Intergenic
1034688285 7:152993575-152993597 TTGATGGTGGGAATGGAAAATGG + Intergenic
1037468370 8:19183341-19183363 TTGGGGCTGTGAGTGGAGAAGGG + Intergenic
1037554153 8:20005672-20005694 TTGCTGGTGGGAGTGTCAAATGG + Intergenic
1037660735 8:20924505-20924527 TGGAGGCAGGCAGTGGCAAGTGG - Intergenic
1038036539 8:23691214-23691236 ATGCGGCAGGGAGTGGCAGAGGG - Intergenic
1038207882 8:25486001-25486023 ATGAGGCTTGGAATGGAAAAGGG - Intronic
1039739028 8:40362940-40362962 TAGTGTCTGGGAGGGGCAAATGG - Intergenic
1039788190 8:40852214-40852236 TAGAGGCTGGGAGGGGCAGTGGG - Intronic
1039939616 8:42078600-42078622 TTGCTGCTGGGAGTGTAAAATGG - Intergenic
1040428043 8:47308855-47308877 TTGGGGCTGAGGGTGGCAAATGG + Intronic
1041283959 8:56241293-56241315 TAGAGGCTGGGAGGGGTAGAAGG + Intergenic
1041578644 8:59430693-59430715 TTCAGGCTGTGAAAGGCAAAAGG - Intergenic
1042440626 8:68821705-68821727 TTGGGACTGGGAGTGGCAGTAGG + Intergenic
1043392868 8:79808385-79808407 TTGAGGCTGTGTGGAGCAAACGG + Intergenic
1044212348 8:89564241-89564263 GTCAGGCTGAGAATGGCAAATGG - Intergenic
1047548407 8:125842413-125842435 TTGAGGGTGGGAGTGGGAGTGGG + Intergenic
1048293496 8:133197839-133197861 CTGAGTCTGGGAGTGGAGAAAGG + Intronic
1048525034 8:135194636-135194658 GTAAGGCAGGGAGTGGCCAATGG - Intergenic
1049349267 8:142155246-142155268 TTAAGGCTTGAAGAGGCAAAGGG + Intergenic
1049355492 8:142186288-142186310 TTCAGCCTGGTAGTGGCAATGGG - Intergenic
1050530697 9:6586482-6586504 TTGAGGCTGGAAGAGGAGAAGGG + Intronic
1052390358 9:27872097-27872119 TTGAGGCAGAGAAGGGCAAAGGG + Intergenic
1053462424 9:38281071-38281093 TTGAGGCTGGCAGAGGGGAAGGG - Intergenic
1054815687 9:69472834-69472856 TGGAGGATGGGAATGGCAAAGGG + Intronic
1054906558 9:70418739-70418761 TTGAGGAGGGGAGAGGCTAAAGG + Intergenic
1055387636 9:75780488-75780510 TAGAGGCTGGGAAGGGCAATTGG + Intergenic
1057442454 9:95091919-95091941 TTGGGGCTGGGGGTGGGAAAAGG + Intergenic
1057476323 9:95405937-95405959 TTGAGGCAGGGTGTGTGAAAAGG - Intergenic
1059566539 9:115388163-115388185 CTGAAGCTGGGAGTGGGAATGGG + Intronic
1060183214 9:121547926-121547948 TTGAGGATGGGAGTGGAGAAGGG - Intergenic
1060307234 9:122425060-122425082 CTGGGGCTAGGAGTGGCAGAAGG - Intergenic
1060547733 9:124470763-124470785 TTGAGGGTGGCAGTGGGAACAGG + Intronic
1060895232 9:127212786-127212808 TGGAGGATGGGGGTGGGAAAGGG + Intronic
1061035182 9:128109529-128109551 GTGAGGCTGGGAGGGGCAGCTGG - Intergenic
1061302173 9:129711722-129711744 TTGAGGCTGGGAGCGGTTAAAGG + Intronic
1061606843 9:131717184-131717206 TGGAGGCGGGGAGTTGTAAAGGG - Intronic
1062028227 9:134350338-134350360 CTGAGGCTTGGAGGGGCAAAGGG - Intronic
1203355804 Un_KI270442v1:141488-141510 TTGAGGCTGTCAGTGGAAATTGG - Intergenic
1185566552 X:1099548-1099570 TTGAGGCTGGGCGGGGCTGAGGG - Intergenic
1185704024 X:2253105-2253127 TTGAGCCTGGGAGGCGCACATGG + Intronic
1186644021 X:11486948-11486970 TGGAGGCTGGTGGTGGCAATGGG + Intronic
1186884634 X:13901008-13901030 ATGAGGCTCAGAGAGGCAAAGGG - Intronic
1187131186 X:16504484-16504506 CAGAGGCTGGGAATGGCAACGGG - Intergenic
1187494354 X:19781688-19781710 GTGAAGCTGGGAGTGGGAATGGG + Intronic
1187622607 X:21075000-21075022 TGGAGGATGGGTGTGGCATATGG + Intergenic
1189385085 X:40530684-40530706 TGGAGGCTGGAAGTGCCCAAAGG - Intergenic
1189856238 X:45228263-45228285 TTCAGGCGTGGAGTGGCAAGGGG + Intergenic
1190739982 X:53282283-53282305 TTGAGGCCTGGAGAGGAAAAGGG + Intronic
1190981696 X:55462343-55462365 TTGTGTCTGGGAGTGCCCAAAGG + Intergenic
1190987002 X:55510837-55510859 TTGTGTCTGGGAGTGCCCAAAGG - Intergenic
1192109153 X:68346661-68346683 CTGAGGCTGGGAGAGGGAAAAGG + Intronic
1192362116 X:70446641-70446663 TTTAGGCTGGGAGTGGAAGCCGG - Intronic
1192507555 X:71698192-71698214 CTGATGCTGGAAGTAGCAAATGG - Intergenic
1192519141 X:71783360-71783382 CTGATGCTGGAAGTAGCAAATGG + Intergenic
1193183761 X:78488105-78488127 TAGAGGCTGGGAAGGGGAAAAGG + Intergenic
1193567883 X:83101115-83101137 TTAAGGCTGGAAGTGGGGAAGGG + Intergenic
1193811913 X:86061774-86061796 TAGAGGCTGGGAAGGGTAAAGGG + Intergenic
1194861219 X:99000992-99001014 TTTCTGCTGGGAGTGGAAAATGG + Intergenic
1195452968 X:105036190-105036212 TGGGTGCTGGGAGTGGGAAAGGG - Intronic
1196143850 X:112295606-112295628 CTGAGGCTTGGAGTTGCAGAAGG - Intergenic
1196698689 X:118642313-118642335 GTGAGGCTGGGAATGAGAAAGGG + Intronic
1196739112 X:119008638-119008660 GTTAGGCTGGGAGTGGGACAGGG + Intronic
1197017669 X:121647188-121647210 TTGAGGATGAGAGTGGTAATAGG + Intergenic
1197569020 X:128126777-128126799 TTGATGATGGGAGTGTAAAATGG + Intergenic
1199551971 X:149070461-149070483 TTGAGACAGGCAGTAGCAAAAGG + Intergenic
1200418379 Y:2935952-2935974 TTGAGGCGGGGATGGGGAAAAGG + Intronic
1200822910 Y:7606285-7606307 TTCTGGCTGGAATTGGCAAAGGG + Intergenic
1202100010 Y:21297716-21297738 TTGAGTCTGTGAGCTGCAAAAGG + Intergenic
1202237145 Y:22724814-22724836 TTCTGGCTGGAATTGGCAAAGGG - Intergenic