ID: 1023906222

View in Genome Browser
Species Human (GRCh38)
Location 7:44523482-44523504
Sequence GCATGCCTTGAGGCTGGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 615
Summary {0: 1, 1: 0, 2: 0, 3: 54, 4: 560}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023906222_1023906228 28 Left 1023906222 7:44523482-44523504 CCACTCCCAGCCTCAAGGCATGC 0: 1
1: 0
2: 0
3: 54
4: 560
Right 1023906228 7:44523533-44523555 GTACACAGCTTGCAGGAGCCAGG No data
1023906222_1023906227 21 Left 1023906222 7:44523482-44523504 CCACTCCCAGCCTCAAGGCATGC 0: 1
1: 0
2: 0
3: 54
4: 560
Right 1023906227 7:44523526-44523548 GCAGCTTGTACACAGCTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023906222 Original CRISPR GCATGCCTTGAGGCTGGGAG TGG (reversed) Intronic
900194177 1:1365899-1365921 GGATGGCCTGAGCCTGGGAGGGG + Intergenic
900277160 1:1838113-1838135 GAATGGCTTGAACCTGGGAGGGG + Intronic
900398920 1:2464951-2464973 GCAGGCCCTGAGGCTGGGCTTGG + Intronic
900693811 1:3997617-3997639 GGATGCTTTGAGGCTGGTTGGGG + Intergenic
900743461 1:4344366-4344388 GCATCCCTGCAGGCTGGCAGGGG + Intergenic
901003840 1:6162089-6162111 AAATGCCTTGAGGCTGGGCGCGG + Intronic
901827972 1:11874909-11874931 GCAACCCTGGAGGCTGGGAGAGG + Intergenic
902369575 1:15997412-15997434 GGATGCCTGGAGCCTGGGACTGG - Intergenic
902516379 1:16991907-16991929 CCCTGCCTGGTGGCTGGGAGAGG - Intronic
902631295 1:17706159-17706181 GCAGGCATTGAGGCTGGAAGCGG - Intergenic
903886606 1:26544560-26544582 GAATGGCTTGAACCTGGGAGGGG - Intronic
904773856 1:32895143-32895165 AGAGGCCTGGAGGCTGGGAGAGG - Intronic
904783253 1:32966139-32966161 GACTGCCTTGGGGCTGGGCGCGG + Intergenic
905723283 1:40225962-40225984 GAATCGCTTGAGCCTGGGAGTGG + Intronic
907668602 1:56454363-56454385 GTATGCCTTAAGGCCGGGCGCGG - Intergenic
910859449 1:91729731-91729753 CCTTGACTTGAGGCAGGGAGAGG - Intronic
911575591 1:99573647-99573669 GCATGCCTGAACCCTGGGAGGGG + Intergenic
912364174 1:109119282-109119304 GGATGGCTTGAGCCTGGGAGGGG - Intronic
912460443 1:109827489-109827511 GGATCACTTGAGCCTGGGAGTGG - Intergenic
914683456 1:149957744-149957766 GGAGGCAGTGAGGCTGGGAGAGG - Intronic
914800957 1:150962254-150962276 GAATCTCTTGAGCCTGGGAGGGG - Intronic
915407578 1:155673104-155673126 GGATGGCTTGAGCCTGGGAGGGG - Intronic
915433540 1:155885872-155885894 ACAGGCCTTGAGGCCGGGTGCGG - Intergenic
915984972 1:160455641-160455663 GAATCACTTGAGCCTGGGAGGGG - Intergenic
916075925 1:161199984-161200006 GGCTGACTTGAGGCTGGGGGAGG - Intronic
916717708 1:167459045-167459067 GAATTGCTTGAAGCTGGGAGGGG + Intronic
917430398 1:174961756-174961778 GAATCGCTTGAGCCTGGGAGGGG + Intronic
918638684 1:186811806-186811828 TCAGGCCTTGAGTCTTGGAGTGG - Intergenic
918733172 1:188023397-188023419 GCATGCGTGAAGGCTTGGAGTGG - Intergenic
919634293 1:199988783-199988805 GGATGACTTGAGCCTCGGAGGGG + Intergenic
919709442 1:200711205-200711227 GAATGACTTGAATCTGGGAGGGG + Intergenic
919975138 1:202605542-202605564 GCAAGGCTAGAGTCTGGGAGAGG - Intronic
922707651 1:227797779-227797801 GGATGGCTTGAACCTGGGAGTGG + Intergenic
923015033 1:230120150-230120172 GCATGCGTTGGGGGTGGGGGTGG + Intronic
923161606 1:231319053-231319075 GCAGGCTTTGAGCCTGGAAGTGG + Intergenic
924356158 1:243178491-243178513 GGCTGCCAGGAGGCTGGGAGAGG + Intronic
924614403 1:245600680-245600702 GTAAGGCTTGAGGCTGGGCGTGG + Intronic
1063637541 10:7798322-7798344 GAATCGCTTGAGCCTGGGAGGGG - Intronic
1063706966 10:8440064-8440086 GCAGGCCATCAGGCTGGAAGAGG + Intergenic
1064050350 10:12054532-12054554 GAATTGCTTGAGCCTGGGAGGGG - Intergenic
1064138492 10:12770811-12770833 GAAAGCCTGAAGGCTGGGAGAGG + Intronic
1064356142 10:14620104-14620126 GAATGGCTTGAACCTGGGAGCGG - Intronic
1064589426 10:16873429-16873451 GTATCCTTTGAGGCTGGGTGCGG + Intronic
1064874323 10:19975914-19975936 GAATGGCTTGAACCTGGGAGGGG + Intronic
1065001968 10:21345521-21345543 GCATGCATTGGGGCTGGAGGGGG + Intergenic
1067061844 10:43081722-43081744 GCACCCCTTGGGGCTGGAAGGGG + Intronic
1067783258 10:49224467-49224489 AAATGCCTTTAGGCTGGGTGTGG + Intergenic
1067842092 10:49688990-49689012 GCATGCTTTGAGGAGGGAAGGGG + Intronic
1068985182 10:63101648-63101670 CCATGACTTCAGGCTGGGTGTGG + Intergenic
1069213974 10:65796645-65796667 GCATGACTTGGGGAGGGGAGAGG + Intergenic
1069294461 10:66826905-66826927 GCCAGGCTGGAGGCTGGGAGTGG - Intronic
1069446281 10:68475981-68476003 GGATGGCTTGATCCTGGGAGGGG - Intergenic
1069510703 10:69040464-69040486 GAATCCCTTGAACCTGGGAGGGG - Intergenic
1069741682 10:70689013-70689035 CCACCCCTTGAGGCTGGCAGGGG + Intronic
1070113032 10:73502965-73502987 GCCTGCCTGGATGTTGGGAGTGG - Intronic
1070336799 10:75463188-75463210 GCATGTCTTGAGTATGGGATGGG + Intronic
1070794620 10:79209524-79209546 GCCTATCCTGAGGCTGGGAGAGG + Intronic
1071531767 10:86395235-86395257 GAATCACTTGAGCCTGGGAGTGG - Intergenic
1071601329 10:86959949-86959971 GCCTGCCTTGGGGCTGGGGCTGG + Intronic
1072216561 10:93292036-93292058 GAATTGCTTGAGCCTGGGAGGGG + Intergenic
1072267195 10:93742232-93742254 GGATGGCTTGAGCCTGGGGGTGG - Intergenic
1073117945 10:101102839-101102861 GAATGGCTTGAGCCTGGGAGGGG - Intronic
1073208373 10:101780431-101780453 CCTTGACTAGAGGCTGGGAGTGG + Intergenic
1073948772 10:108783590-108783612 CCATCACTTGAGGCTGGAAGAGG + Intergenic
1074110856 10:110421864-110421886 GCAGGCAGTGTGGCTGGGAGGGG + Intergenic
1074392271 10:113068410-113068432 GCAAGCCAGGATGCTGGGAGAGG + Intronic
1074533126 10:114310586-114310608 GCAGGCCTTGGGGCTGGGGTCGG - Intronic
1074692169 10:116016144-116016166 TCAAGCCCTGAAGCTGGGAGAGG - Intergenic
1075563599 10:123486851-123486873 CCTTGCCCTGAGGCTGGGTGTGG + Intergenic
1075840716 10:125500156-125500178 GAATCGCTTGAGCCTGGGAGGGG - Intergenic
1075872247 10:125779457-125779479 ACAGGCCCTGAGGCTGGGACTGG + Intergenic
1076413039 10:130265293-130265315 CCATGACTTGAGGCTCAGAGAGG - Intergenic
1076833244 10:133007411-133007433 GCCTGGCTGGGGGCTGGGAGGGG - Intergenic
1077089481 11:771946-771968 ACAGGCCCTGAGGCAGGGAGAGG - Intronic
1077166376 11:1141314-1141336 CGATGCCTTCTGGCTGGGAGGGG - Intergenic
1077602270 11:3581857-3581879 GCAGGTCTTGGAGCTGGGAGAGG + Intergenic
1077634418 11:3832487-3832509 GCTGCCCTTGAGGCTGGGAGGGG - Intronic
1077676030 11:4193600-4193622 CTCTGCCTTGAGGCTGGCAGTGG - Intergenic
1078430124 11:11281900-11281922 CCCTCCCTGGAGGCTGGGAGGGG + Intronic
1079083692 11:17430751-17430773 GCAAGCCTTGAGGCTGACACAGG + Intronic
1080813922 11:35735325-35735347 CCATGCATTCAGGTTGGGAGAGG + Intronic
1080853390 11:36090866-36090888 GGTAGCCTTGGGGCTGGGAGAGG + Intronic
1081757838 11:45557202-45557224 TCATTCCCTGGGGCTGGGAGTGG - Intergenic
1081901116 11:46628904-46628926 GTATTGCTTGGGGCTGGGAGTGG - Intronic
1082778983 11:57271435-57271457 CAATCCCCTGAGGCTGGGAGAGG - Intergenic
1082882781 11:58054641-58054663 GCATGCGTTGAGGCCAGGTGTGG + Intronic
1082946254 11:58763912-58763934 ACATGCCTTTTGGCTGTGAGTGG + Intergenic
1083259062 11:61513465-61513487 GCTTGCCTGGAGGCTGGTGGGGG - Intergenic
1083314203 11:61804245-61804267 GCTGGCCTTGAGGCTGGGCAGGG - Intronic
1083388234 11:62328510-62328532 GAATGGCTTGAACCTGGGAGGGG + Intergenic
1083763867 11:64832982-64833004 GGATGAGGTGAGGCTGGGAGGGG + Intronic
1084088581 11:66865950-66865972 GGAAGCCGTGAGGGTGGGAGCGG - Intronic
1084779086 11:71397007-71397029 TCCTGCCTTCAGACTGGGAGTGG + Intergenic
1084790534 11:71472899-71472921 CACTGCCTTGTGGCTGGGAGTGG + Intronic
1084814577 11:71638806-71638828 GCAGGTCTTGGAGCTGGGAGAGG - Intergenic
1084934257 11:72578662-72578684 GGATGGCCTGAGGCAGGGAGTGG + Intronic
1085463316 11:76708101-76708123 GCATGCCTGGAGGCTGAGGCAGG - Intergenic
1085628706 11:78094556-78094578 GGATGGCTTGAACCTGGGAGGGG - Intergenic
1087164211 11:94984405-94984427 GGATGGCTTGAGCCTTGGAGAGG + Intronic
1088635549 11:111816848-111816870 GAATGACTTGGGGCTGGGTGTGG - Intronic
1089053022 11:115562289-115562311 GCATGCATTCATGCTGGGAAGGG + Intergenic
1089481828 11:118811924-118811946 GAATGGCTTGAACCTGGGAGTGG + Intergenic
1089555718 11:119315162-119315184 GGTTGCCTTGGGACTGGGAGAGG + Exonic
1089626267 11:119753044-119753066 GCCTGCATGGAGGCTGGGAAGGG - Intergenic
1089710696 11:120312411-120312433 CCATGCCTTTGGGCTGGGTGCGG - Intronic
1090422989 11:126588505-126588527 GCGGGCCCTGAGGCAGGGAGGGG + Intronic
1090670218 11:128940746-128940768 GCATGCCTTGAGTGTGTGGGTGG - Intronic
1091316985 11:134621383-134621405 GCATGCCTGGAGGAGGAGAGTGG + Intergenic
1091577527 12:1752319-1752341 GGATTACTTGAGCCTGGGAGGGG - Intronic
1091581654 12:1793970-1793992 GCTTGCCCTCAGGCTTGGAGTGG + Intronic
1092087385 12:5774376-5774398 GGATGCCTTGAGCCTGAGATGGG + Intronic
1092189945 12:6511894-6511916 GCATCACTTGAACCTGGGAGAGG + Intronic
1092428415 12:8391210-8391232 GCAGGTCTTGGAGCTGGGAGAGG + Intergenic
1092429496 12:8397361-8397383 GCAGGTCTTGGAGCTGGGAGAGG + Intergenic
1092896307 12:13013905-13013927 GCATACTTTTAGGCTGGGCGTGG - Intergenic
1093043405 12:14412721-14412743 GTATGACTTGTGGCTGGGTGTGG + Intronic
1094003575 12:25723341-25723363 GCCTCCCTTGAGTCTGGGAGTGG + Intergenic
1095419038 12:42006190-42006212 GGATCACTTGAGGCTAGGAGGGG + Intergenic
1095863983 12:46951339-46951361 GAATGCCTTGAATCTGGGAGGGG + Intergenic
1096567815 12:52496060-52496082 GCATGCCTGGCAGCTGGGAATGG - Intergenic
1096585414 12:52616576-52616598 GCAGCCCTTAAGGTTGGGAGGGG + Intronic
1096724521 12:53550234-53550256 GAATCGCTTGAGCCTGGGAGGGG + Intronic
1096804300 12:54130968-54130990 GTATGCCTTGAGGATGGGCTGGG + Intergenic
1096867238 12:54571910-54571932 GAATCTCTTGAGGCTAGGAGGGG - Intronic
1096995996 12:55838600-55838622 GGATGCCATGATGCTGGGTGAGG - Exonic
1097289122 12:57899115-57899137 GCCTGGCCTGGGGCTGGGAGTGG - Intergenic
1097352763 12:58566502-58566524 GAATGGCTTGAACCTGGGAGGGG + Intronic
1097384347 12:58931826-58931848 GATTGCCTGGAGGCAGGGAGAGG - Intergenic
1098711302 12:73765743-73765765 GAATTGCTTGAGCCTGGGAGGGG + Intergenic
1098822449 12:75250038-75250060 GCAGGTTTTGAAGCTGGGAGGGG - Intergenic
1100603003 12:96128440-96128462 ACATGCCTTTTGGCTGGGTGCGG - Intergenic
1100936817 12:99679393-99679415 GGATGGCTTGAGCCTGGGGGTGG - Intronic
1100964958 12:100002504-100002526 GCTTGCCTTGCAGCTGGGGGTGG - Intergenic
1103217349 12:119212167-119212189 GGATGTCTTCAGGCTGTGAGGGG + Intronic
1103393834 12:120592875-120592897 TCATCCATTGCGGCTGGGAGTGG - Intergenic
1103594539 12:122016111-122016133 GGATCACTTGAGCCTGGGAGGGG + Intergenic
1103678988 12:122678454-122678476 GAATTGCTTGAGCCTGGGAGGGG - Intergenic
1104329917 12:127835175-127835197 GCCCTCCTTGAGGCAGGGAGAGG - Intergenic
1104580306 12:130006714-130006736 TGCTGCCTTGAGGCTGAGAGGGG + Intergenic
1105370509 13:19797999-19798021 GGATTGCTTGAGTCTGGGAGTGG - Intergenic
1105724684 13:23150310-23150332 GCATTTCTAGAGGCTGGAAGTGG + Intergenic
1105992433 13:25635989-25636011 GCATGCCTGGAGGATGGACGAGG + Intronic
1106075437 13:26456767-26456789 GCATGGGTTGGGGCGGGGAGGGG + Intergenic
1106137551 13:26985039-26985061 GGATGGCTTCAGCCTGGGAGTGG - Intergenic
1106179760 13:27360648-27360670 GCATGCATGGTAGCTGGGAGAGG - Intergenic
1106284689 13:28308448-28308470 AGCAGCCTTGAGGCTGGGAGGGG - Intronic
1106816283 13:33410841-33410863 GCTTGGGTTGAGGCTGGGAGAGG - Intergenic
1107560965 13:41556939-41556961 GAATTGCTTGAGCCTGGGAGGGG + Intergenic
1108373668 13:49793882-49793904 GCATGCCTGGAGGCTGAGGCAGG + Intergenic
1109182398 13:59229567-59229589 GCTCGCCTCCAGGCTGGGAGTGG - Intergenic
1109429897 13:62218202-62218224 GGATGGCTTGAGCCTGGGAGGGG - Intergenic
1112180795 13:97078051-97078073 ACATGCCTGGAGGCTGAGACAGG + Intergenic
1112187759 13:97144395-97144417 TCATGTCTAGAGGCAGGGAGAGG - Intergenic
1112262571 13:97890572-97890594 TCATTCTTTGAGGCTGGGGGTGG - Intergenic
1112336967 13:98524042-98524064 GCCTGCTTTGGGGCTGGGTGTGG - Intronic
1112527931 13:100169988-100170010 GCATGAGTTCAGGCTGGGTGTGG - Intronic
1113145576 13:107203920-107203942 GCATGCCTGGAGGCAGAGGGGGG + Intronic
1114055394 14:18963851-18963873 GGATCACTTGAGACTGGGAGTGG + Intergenic
1114107151 14:19437912-19437934 GGATCACTTGAGACTGGGAGTGG - Intergenic
1114133827 14:19823920-19823942 GCATGCCTGGAGTCTGAGTGTGG - Intronic
1114660209 14:24338977-24338999 CCTTGTCTTGAGGCTGAGAGGGG + Intronic
1114840385 14:26256228-26256250 AAATGCCTTGAGGCAGGAAGGGG - Intergenic
1114960470 14:27881808-27881830 GCATCCCTGGATGCTGGAAGAGG - Intergenic
1116782467 14:49251144-49251166 GCATGCATTCATGCTGGCAGAGG - Intergenic
1116783634 14:49265080-49265102 TCAAGCTTGGAGGCTGGGAGAGG + Intergenic
1118358761 14:65038118-65038140 GAATACTTTGAGGCTGGGCGTGG + Intronic
1118788531 14:69067429-69067451 GGATTGCTTGAGCCTGGGAGCGG - Intronic
1119479870 14:74952437-74952459 GCAGGCCCTGAGGCTCAGAGAGG - Intronic
1119520854 14:75284095-75284117 GTATGACTTGAGCCTGGGAGGGG + Intergenic
1120982121 14:90299336-90299358 GCAGACCTTTAGGCTGGGCGCGG - Intronic
1121084430 14:91135010-91135032 GGATTGCTTGAGCCTGGGAGGGG - Intronic
1122383286 14:101325803-101325825 CCCTGCCTTGGGGCAGGGAGGGG - Intergenic
1122595080 14:102884951-102884973 GCATCCCCTGATACTGGGAGTGG + Intronic
1122723224 14:103734110-103734132 CCTTGCCTTGAGGCTGGGCCTGG + Exonic
1122748567 14:103915903-103915925 GCATGGCATCAGGGTGGGAGAGG - Intronic
1122801015 14:104229511-104229533 GCATCCCATCAGGCTGGGTGGGG - Intergenic
1122857731 14:104567951-104567973 GGCTGCCCTGGGGCTGGGAGTGG - Intronic
1122936546 14:104960619-104960641 GCATTGCCTGGGGCTGGGAGTGG + Intronic
1123576899 15:21679507-21679529 GCATGCCTGGAGTCTGAGTGTGG - Intergenic
1123613521 15:22121975-22121997 GCATGCCTGGAGTCTGAGTGTGG - Intergenic
1123701032 15:22914979-22915001 GCATGGCTTGGGGCTGAGCGAGG - Intronic
1123955468 15:25330030-25330052 GCATGATTTGAGGGTGGGGGTGG + Intergenic
1124996388 15:34727125-34727147 TCAGGCCTTCAGGCTGGGACTGG - Intergenic
1125152367 15:36547236-36547258 GCCTGCCTTGGGGCAGAGAGAGG + Intergenic
1125279669 15:38030480-38030502 GCAAACCTGGAGGCTGGCAGAGG - Intergenic
1125620941 15:41061214-41061236 GAATTGCTTGAGCCTGGGAGAGG + Intronic
1126115416 15:45203080-45203102 GAATTGCTTGAGCCTGGGAGGGG + Intergenic
1126167978 15:45669716-45669738 GAATGTCTTGGGGCTGGGGGAGG - Intronic
1127659084 15:61083224-61083246 GGATGCTTTCAGGCTGGGAGAGG - Intronic
1129238942 15:74240447-74240469 TCCTGCAGTGAGGCTGGGAGGGG - Intronic
1130103475 15:80911886-80911908 GCAGGGCTGGAGGCTGGGAGAGG + Intronic
1131109956 15:89758808-89758830 GAGGGCCTTGGGGCTGGGAGGGG - Intergenic
1131812893 15:96190998-96191020 GGATTGCTTGAGCCTGGGAGGGG + Intergenic
1132126871 15:99235158-99235180 GGATGGCTTGAGCCTGGGAGGGG + Intronic
1132393989 15:101459091-101459113 GCTAGCAGTGAGGCTGGGAGAGG - Intronic
1202985767 15_KI270727v1_random:413752-413774 GCATGCCTGGAGTCTGAGTGTGG - Intergenic
1132486602 16:195711-195733 GCCATCCTTGAGGCTGGGTGTGG - Intronic
1132872457 16:2121959-2121981 GCAGGGCTGGAGGCTGGCAGGGG - Intronic
1132877270 16:2145621-2145643 GTAGGCCTGGAGGCAGGGAGGGG - Intronic
1132986127 16:2768611-2768633 TCCTGCCTGGAGGCAGGGAGAGG - Intronic
1133357200 16:5145275-5145297 GTATGGCTTCAGGCTGGGCGCGG - Intergenic
1133415743 16:5605651-5605673 GTCTGCCTTGAGTCTAGGAGGGG + Intergenic
1133664043 16:7947750-7947772 GGATCGCTTGAGTCTGGGAGTGG - Intergenic
1133948603 16:10370655-10370677 GCCTGCCTTGGGGCTAGGACAGG + Intronic
1134131897 16:11655797-11655819 ACCTGTCTTGGGGCTGGGAGAGG + Intergenic
1134278461 16:12797465-12797487 GCATGGCTTGAGCCCAGGAGGGG + Intronic
1135465270 16:22679587-22679609 GCATCCACTGAGGCTGGGGGTGG + Intergenic
1135631767 16:24041135-24041157 GAATGGCTTGAACCTGGGAGGGG - Intronic
1136145491 16:28313932-28313954 GCATTGCTGGAGGCTGGGAGGGG - Intronic
1136986006 16:35105947-35105969 GTATGCCTTTTGGCTGGGCGTGG + Intergenic
1139310110 16:66021105-66021127 GCATGCCTTAAGGTGGGGGGGGG - Intergenic
1139717101 16:68822455-68822477 GGGTGGCTAGAGGCTGGGAGAGG - Intronic
1140116218 16:72043762-72043784 GGATCACTTGAGCCTGGGAGAGG - Intergenic
1140128197 16:72135261-72135283 GAATGGCTTGAAGCCGGGAGGGG - Intronic
1140693855 16:77512151-77512173 GCATCCCATAAGGCTGGAAGTGG - Intergenic
1141128643 16:81419202-81419224 GGATGGCTTGAGGCAGGAAGTGG + Intergenic
1141180550 16:81750330-81750352 GAATCCCTTGAACCTGGGAGGGG + Intronic
1141621670 16:85239604-85239626 GCAGGAGATGAGGCTGGGAGAGG + Intergenic
1142419921 16:89963918-89963940 GGATGCGGTGTGGCTGGGAGGGG + Intronic
1143090905 17:4448681-4448703 GCACGCCATGAGGCTTGGAGAGG - Intronic
1143600576 17:7943089-7943111 ACATACCCTGAGGCTGGGCGCGG - Intronic
1144078025 17:11736478-11736500 GGATGCTTGGAGGCAGGGAGGGG - Intronic
1144123319 17:12177995-12178017 GAATCCCTTGAACCTGGGAGGGG + Intergenic
1144783488 17:17819448-17819470 GCAGGACCTGAGGGTGGGAGAGG + Exonic
1144834334 17:18149008-18149030 GCAGGCCTTCTGCCTGGGAGTGG - Intronic
1145127766 17:20316004-20316026 GCCTGCCTTGTGGCTGCCAGGGG - Intronic
1145184087 17:20779477-20779499 GATTGCCTTGAGGCTGGGCATGG + Intergenic
1146545360 17:33733704-33733726 TGATGACATGAGGCTGGGAGAGG - Intronic
1147192410 17:38745828-38745850 TCCTGCCTTGAGGCAGGAAGAGG + Intronic
1147279636 17:39348371-39348393 GAATCCCTTGAACCTGGGAGCGG + Intronic
1147585253 17:41650948-41650970 TCCTGCCTTGAGGCTGGGTCAGG - Intergenic
1147952028 17:44112690-44112712 TCCTGCCCTCAGGCTGGGAGTGG + Intronic
1147977376 17:44255480-44255502 GCATGCCATGAAAGTGGGAGGGG + Intronic
1148169239 17:45505393-45505415 GCCTGCCTGTAGCCTGGGAGGGG - Intergenic
1148806636 17:50267178-50267200 CCCTGCCTGGAGGGTGGGAGGGG - Intergenic
1149621072 17:58045434-58045456 GGATCACTTGAGTCTGGGAGGGG + Intergenic
1150111429 17:62503814-62503836 GAATGGCTTGAACCTGGGAGGGG - Intronic
1150127056 17:62644126-62644148 ACATGTCTGGAGGCTGGGTGTGG + Intronic
1150427761 17:65090111-65090133 GGATCACTTGAGCCTGGGAGTGG + Intergenic
1150489155 17:65562420-65562442 GCATGCCTTGTCGTTTGGAGTGG - Intronic
1150491028 17:65574447-65574469 GCAAGACTTGAGCATGGGAGTGG - Intronic
1150651806 17:67015353-67015375 GGATGCCTTGGGTCAGGGAGGGG + Intronic
1150666370 17:67142842-67142864 GGATGGCTTGAACCTGGGAGGGG - Intronic
1150757640 17:67930026-67930048 GGATGGCTTGAGCCTGGGAGGGG + Intronic
1150846691 17:68665889-68665911 GGATTGCTTGAGACTGGGAGGGG + Intergenic
1151287002 17:73119411-73119433 ACATGCCTTGAGGAAGGGTGTGG - Intergenic
1151513879 17:74579795-74579817 GGATCGCTTGAGCCTGGGAGGGG + Exonic
1151719677 17:75847964-75847986 GCCTGCCTTGGGGCGGGGAGAGG + Intronic
1152192621 17:78897708-78897730 TCATGCCTTGAGGAGGAGAGAGG - Intronic
1152760564 17:82105163-82105185 GCCTGCCTTGGGGCTGGGGAGGG + Intronic
1152867483 17:82732818-82732840 GAATTGCTTGAGCCTGGGAGTGG - Intergenic
1203171241 17_GL000205v2_random:149249-149271 GCATCCCAGGAGCCTGGGAGGGG + Intergenic
1153036405 18:767235-767257 GGATGTCTTGAGCCTGGAAGGGG - Intronic
1153351155 18:4082252-4082274 GAATTCCTTGAACCTGGGAGGGG + Intronic
1155284426 18:24273196-24273218 AGATGCCATGAGGCTGGGCGTGG - Intronic
1155481751 18:26296464-26296486 GCAAGCCTTGAGGCATGGGGTGG + Intronic
1155673027 18:28395164-28395186 GGATCACTTGAGCCTGGGAGTGG + Intergenic
1155725851 18:29082260-29082282 ACAGGTCTTGAGGCTGGGAATGG + Intergenic
1156070008 18:33195864-33195886 GCATCCTTTGAGGCTGGATGTGG + Intronic
1157688563 18:49662472-49662494 GCATGGCCTGAGGAGGGGAGAGG + Intergenic
1158606977 18:58904262-58904284 GAATGGTTTGAGCCTGGGAGGGG + Intronic
1159038042 18:63296388-63296410 GGATCCCTTGAGGCTGAGATGGG - Intronic
1159184662 18:64953329-64953351 GCTTCCCTTGTGGGTGGGAGGGG - Intergenic
1159312165 18:66723350-66723372 GGATCCCTTGAACCTGGGAGGGG - Intergenic
1161114723 19:2490209-2490231 GAATCGCTTGAGCCTGGGAGGGG - Intergenic
1161448272 19:4329824-4329846 GACTGCCTTGGGGCTGGGGGTGG - Intronic
1161458930 19:4385014-4385036 GAATTGCTTGAGCCTGGGAGCGG + Intronic
1162789090 19:13053883-13053905 GCACCCCTTGAGGGTGGGACTGG - Intronic
1163122331 19:15225495-15225517 GAATCGCTTGAGCCTGGGAGGGG + Intergenic
1163288782 19:16365160-16365182 CCAAGCCCTGGGGCTGGGAGTGG + Intronic
1163634373 19:18431475-18431497 TCATGGCTTGAGGGTGGGAGGGG - Intronic
1163652952 19:18529564-18529586 GGATGACTTGAGGCTGAGTGTGG - Intergenic
1163690500 19:18735959-18735981 TCTTGCCTTGAGTCTGGCAGGGG + Intronic
1163779531 19:19239309-19239331 GCCTACACTGAGGCTGGGAGAGG + Intronic
1163878315 19:19895514-19895536 GCATGCCTGGAGGCTGAGGCAGG + Intergenic
1164208011 19:23073792-23073814 GAATCCCTTGAACCTGGGAGAGG + Intergenic
1165067158 19:33235963-33235985 GGAGGCCTTGAGCCTGGGAAAGG + Intergenic
1165157630 19:33797540-33797562 GCAGGGTTTGGGGCTGGGAGAGG + Intronic
1165232691 19:34396896-34396918 GAATCACTTGAGGCCGGGAGGGG - Intronic
1165365142 19:35360604-35360626 GGATGCCTGGATGCTGGGAGAGG + Intergenic
1165366960 19:35373072-35373094 GGATGCCTGGATGCTGGGAGAGG + Intergenic
1166535091 19:43568407-43568429 GAATCACTTGAAGCTGGGAGGGG + Intronic
1166737370 19:45093967-45093989 GCAAGCCTTGGGGCAAGGAGTGG + Intronic
1167153691 19:47725258-47725280 GGAGGCCGTGAGGCTGGGCGCGG + Intronic
1167332049 19:48862037-48862059 GGATCACTTGAGCCTGGGAGTGG + Intronic
1167647358 19:50712931-50712953 GCAGGTCTGGAGGCTGGGAGGGG + Intronic
1168016938 19:53581489-53581511 AGAGGCCTTGGGGCTGGGAGAGG + Intergenic
925024253 2:595238-595260 GCTTGCCAGGAGGCTGGGGGAGG + Intergenic
925106187 2:1294328-1294350 GCATTCCTTGGGCATGGGAGGGG - Intronic
925665832 2:6254721-6254743 ACATGCCTTGAAGCTGAGACTGG - Intergenic
925966511 2:9071804-9071826 GGATTCTTTGAGGCTGGGAAGGG - Intergenic
926156635 2:10458554-10458576 GCAAGCCTTGATGTTGGTAGGGG + Intergenic
926158654 2:10472823-10472845 GGATGGCTTGAGCCTGGAAGGGG - Intergenic
926621107 2:15048153-15048175 GCAGCCCTAGAGGCAGGGAGAGG + Intergenic
926692609 2:15747898-15747920 GGATGCCTTGGGGCGGGGGGAGG + Intergenic
927089501 2:19699786-19699808 GCAGGCCTTGAGTCTGATAGTGG - Intergenic
927096554 2:19751560-19751582 GCATCCCTTGATGGGGGGAGTGG + Intergenic
927543864 2:23935962-23935984 GAATCCCTTGAACCTGGGAGGGG + Intronic
927681737 2:25144082-25144104 GCCTGGCCTGAGGATGGGAGAGG + Intronic
928085244 2:28342064-28342086 GCATCATTTGAGGCTGGGCGTGG - Intergenic
928772850 2:34722475-34722497 GAATGCATAGTGGCTGGGAGTGG + Intergenic
928945942 2:36772114-36772136 GGCTGCTTTGAGGCTGGGCGTGG + Intronic
929561710 2:42960449-42960471 GCAGGCCCTGTGTCTGGGAGCGG - Intergenic
930006291 2:46899824-46899846 GCTTTCCTTCAGGCTGGGTGCGG + Intergenic
930837928 2:55814437-55814459 GGCTGCAATGAGGCTGGGAGAGG + Intergenic
931591132 2:63884619-63884641 GGATGTTTTGAGGCTGGGTGTGG + Intronic
932194138 2:69768396-69768418 GGATGACTGGAAGCTGGGAGAGG + Intronic
933157887 2:78994235-78994257 GCATCCCCTGAGGCCGGAAGAGG - Intergenic
933654852 2:84879266-84879288 GGAAACCTTGAGCCTGGGAGTGG - Intronic
933807512 2:86011147-86011169 GCATGCCTAGAGATTGGCAGAGG - Intergenic
933976762 2:87518346-87518368 GCCTGCCTTGGGGGTGGGACTGG + Intergenic
934064060 2:88323405-88323427 GAATTGCTTGAGCCTGGGAGGGG - Intergenic
934543769 2:95197711-95197733 CCATGCCTTAAGGATGGCAGAGG + Intergenic
935832262 2:107012395-107012417 GCATGTGTGGTGGCTGGGAGAGG + Intergenic
936011937 2:108930487-108930509 GCAGGCCTTGATGGTGGGATGGG - Intronic
936317053 2:111432458-111432480 GCCTGCCTTGGGGGTGGGACTGG - Intergenic
936384952 2:112020901-112020923 GCATCACTTGAGGCTAGGCGTGG + Intronic
936580942 2:113700065-113700087 GCATCACTTGAGGCATGGAGAGG - Intergenic
937072637 2:119075904-119075926 GCAGGCCCTGAGGCTGGGAAAGG - Intergenic
937342303 2:121099044-121099066 GCATGGGCGGAGGCTGGGAGAGG + Intergenic
937739587 2:125334071-125334093 AGTTGCCTTGAGGCTGGGGGAGG - Intergenic
938106305 2:128532940-128532962 GGTTGCCTTGGGACTGGGAGGGG + Intergenic
939216617 2:139246773-139246795 GTACCCCTTGAGGCTGGGCGCGG - Intergenic
940313985 2:152308418-152308440 TTATTCCTTGAGGCTGGGCGTGG + Intergenic
941918809 2:170829300-170829322 GCTCGCCTTCAGGCAGGGAGGGG - Intronic
942541380 2:177018604-177018626 GCATTCCCTGTGGCTGGAAGAGG - Intergenic
943564261 2:189498672-189498694 GAATGGCTTGAACCTGGGAGCGG + Intergenic
944476470 2:200111863-200111885 GGATTGCTTGAGGCTGGGAAGGG - Intergenic
944619543 2:201499743-201499765 GGATCACTTGAGCCTGGGAGTGG + Intronic
944996547 2:205301266-205301288 GCAAGACTTGATGCTGGGAGTGG - Intronic
945191709 2:207195526-207195548 GAATGGCTTGAACCTGGGAGAGG - Intergenic
945993084 2:216412782-216412804 GCTTACCTTGAGGCTGGGTGAGG + Intronic
946862667 2:224014906-224014928 CCATGCCTTGAGACTCTGAGAGG - Intronic
946903250 2:224392665-224392687 GGATAGCTTGAGCCTGGGAGAGG + Intronic
947823944 2:233091663-233091685 GCTGGCCTCGAGGTTGGGAGAGG - Intronic
948006742 2:234615818-234615840 GGATGTCTTGACCCTGGGAGGGG + Intergenic
948026446 2:234781775-234781797 TTCTGCCTTGAGGCTGGGGGTGG + Intergenic
948051610 2:234983089-234983111 GCAGGCCTAGGGGCTGGGTGGGG + Intronic
948371973 2:237495354-237495376 GAATGCCTTGGGGCAGGGGGTGG + Intronic
949005451 2:241644253-241644275 GGATCCCTTGAGGCCGGAAGGGG + Intronic
1169095854 20:2898206-2898228 GCATGCCTGGAGGCTGAGACAGG - Intronic
1169175128 20:3504595-3504617 GAATCGCTTGAAGCTGGGAGGGG + Intronic
1169207765 20:3749660-3749682 GCAGGGCTGGAGGCTGGGCGAGG + Intronic
1169256391 20:4102948-4102970 GAATCACTTGAAGCTGGGAGGGG + Intergenic
1169533566 20:6512194-6512216 GAATTGCTTGAGCCTGGGAGGGG - Intergenic
1170428085 20:16255547-16255569 GCAGGCTCTGAGCCTGGGAGGGG - Intergenic
1171077976 20:22148606-22148628 GAATGATCTGAGGCTGGGAGAGG + Intergenic
1171189788 20:23150866-23150888 GCAGGCCTTGAAGCTAAGAGAGG + Intergenic
1171475030 20:25402103-25402125 GCCTGCCTGGTGGCTGGGCGCGG + Intergenic
1172056887 20:32160259-32160281 GAATACATGGAGGCTGGGAGAGG - Intronic
1172360171 20:34307174-34307196 GAATGGCTTGAGCCTGGGAGAGG - Intronic
1172528888 20:35617340-35617362 GAATGAGTTGAGGCTCGGAGAGG - Intronic
1172561694 20:35894515-35894537 GCATGCAGTGAGGCTGTGGGTGG + Intronic
1172761373 20:37325598-37325620 GGATCACTTGAGCCTGGGAGGGG - Intergenic
1172776318 20:37409276-37409298 GCAAGCCTTGAGGCTGAGGCTGG - Intergenic
1172872220 20:38142887-38142909 CGATGCCTTGAAGCTGGCAGAGG - Intronic
1173091523 20:39976637-39976659 GAATGGCTTGAGCCTGGTAGGGG - Intergenic
1173251076 20:41364594-41364616 GCAGGCCATGGGGCAGGGAGAGG - Intronic
1173636404 20:44562512-44562534 GGATGGCTTGAGTCTTGGAGGGG + Intronic
1174036258 20:47670278-47670300 GAATGGCTTGAACCTGGGAGCGG - Intronic
1174539047 20:51275051-51275073 GCAGGGCTTGTGGGTGGGAGGGG + Intergenic
1174658772 20:52192580-52192602 AAATCCCTCGAGGCTGGGAGAGG - Intronic
1175298733 20:57927908-57927930 GAATGCTTTGAGGGTGGGGGTGG - Intergenic
1175579034 20:60084868-60084890 GCATGAGTGGAGGCTGGGTGTGG - Intergenic
1176113954 20:63422992-63423014 GCTGGCCCTGAGGCTGGGAGTGG - Intronic
1176243690 20:64086898-64086920 GCCTGCCCTGGGGGTGGGAGTGG + Intronic
1176327223 21:5511079-5511101 GCATCCCAGGAGCCTGGGAGGGG + Intergenic
1176330482 21:5545152-5545174 GCATCCCAGGAGCCTGGGAGGGG - Intergenic
1176397275 21:6275799-6275821 GCATCCCAGGAGCCTGGGAGGGG + Intergenic
1176400534 21:6309872-6309894 GCATCCCAGGAGCCTGGGAGGGG - Intergenic
1176436623 21:6679232-6679254 GCATCCCAGGAGCCTGGGAGGGG + Intergenic
1176439882 21:6713305-6713327 GCATCCCAGGAGCCTGGGAGGGG - Intergenic
1176460885 21:7006302-7006324 GCATCCCAGGAGCCTGGGAGGGG + Intergenic
1176464144 21:7040374-7040396 GCATCCCAGGAGCCTGGGAGGGG - Intergenic
1176484446 21:7388080-7388102 GCATCCCAGGAGCCTGGGAGGGG + Intergenic
1176487705 21:7422153-7422175 GCATCCCAGGAGCCTGGGAGGGG - Intergenic
1177577815 21:22981867-22981889 GCATCTCTTGGTGCTGGGAGAGG + Intergenic
1178284587 21:31315081-31315103 ACATGCAATGAGGCTGGGCGTGG + Intronic
1178325728 21:31643908-31643930 GGATCTCTTGAGCCTGGGAGAGG + Intergenic
1178435894 21:32558249-32558271 GCATTGCTTGAGGCAGGGTGGGG + Intergenic
1178810434 21:35876763-35876785 GCCTCCCTTGAAGCTGGGTGTGG + Intronic
1179530013 21:42011789-42011811 GGATGGCTTGAGCCAGGGAGTGG - Intergenic
1179579154 21:42329212-42329234 GCCAGCCCTGAGGCTGGGAGTGG + Intergenic
1179906068 21:44424008-44424030 GCCTCCCTGGAGGCCGGGAGGGG - Intronic
1180189840 21:46157615-46157637 CCACGTCTGGAGGCTGGGAGTGG + Intergenic
1180473872 22:15686403-15686425 GGATCACTTGAGACTGGGAGTGG + Intergenic
1181040284 22:20188745-20188767 GCATGTGTTGGGGCTGGGCGCGG + Intergenic
1182111977 22:27730547-27730569 GGATGGCTTGAGGCCAGGAGTGG - Intergenic
1182303754 22:29353752-29353774 GCAGGCCCTGTGGCTGGGAGTGG - Intronic
1182340387 22:29615483-29615505 GGATCACTTGAGCCTGGGAGAGG + Intronic
1182355020 22:29719041-29719063 GCAGGCCCTGGGGCTGGGAGTGG - Intergenic
1182637469 22:31740146-31740168 GGATCACTTGAGTCTGGGAGAGG - Intronic
1183465889 22:37980227-37980249 GCAGGCCTTGAGGGTGTGACTGG + Intronic
1183656882 22:39191161-39191183 GGATCACTTGAGCCTGGGAGGGG - Intergenic
1184091168 22:42293709-42293731 GAATGCCCTCAGGCTGGGCGCGG + Intronic
1184607522 22:45582558-45582580 GGAATCATTGAGGCTGGGAGGGG - Intronic
1185066581 22:48635323-48635345 GCAGCCCCTGAGGCTGGTAGAGG + Intronic
949301962 3:2594504-2594526 GAATTGCTTGAGCCTGGGAGAGG - Intronic
949388477 3:3532281-3532303 GGATTCCTTGAGTCTGGGATGGG + Intergenic
949994690 3:9607373-9607395 GAATGGCTTGAATCTGGGAGGGG - Intergenic
950216453 3:11163181-11163203 GCCTACGTTGAGGCTGGGATGGG - Intronic
950312823 3:11974126-11974148 GAAGAACTTGAGGCTGGGAGCGG + Intergenic
950406403 3:12807899-12807921 GCCTCCCTTGCTGCTGGGAGTGG - Intronic
950464120 3:13143260-13143282 GCAGGCCTCGAAGCTGGGGGTGG + Intergenic
950693163 3:14677046-14677068 GCATGGCTTTAGGCTAGGACAGG - Intronic
952799385 3:37274604-37274626 GAATTGCTTGAGCCTGGGAGTGG + Intronic
953163411 3:40442968-40442990 GCATCGCTTGAACCTGGGAGGGG + Intergenic
953958718 3:47250853-47250875 GCAGGCCTTTGGTCTGGGAGAGG - Intronic
954144090 3:48625785-48625807 GCATGCAGTCAGGCTGGCAGTGG - Exonic
954262596 3:49450245-49450267 GAATCCCTTGAACCTGGGAGGGG + Intergenic
954558407 3:51536258-51536280 GCAAGACATGAAGCTGGGAGGGG + Intergenic
955171630 3:56571467-56571489 GAATCGCTTGAGCCTGGGAGGGG - Intronic
955996448 3:64685206-64685228 GCAAGCCTGAAGACTGGGAGGGG - Intronic
957073118 3:75580921-75580943 GCAGGTCTTGGAGCTGGGAGAGG + Intergenic
957694139 3:83611844-83611866 GCATGACTTCAGGATGGCAGAGG + Intergenic
957846090 3:85737643-85737665 GAATGCCATGAACCTGGGAGAGG - Intronic
958187196 3:90137025-90137047 TCAGGCCTTCAGGCTTGGAGTGG - Intergenic
960060148 3:113312371-113312393 GAATTCCTTTAGGCTGGGCGGGG - Intronic
961171279 3:124799470-124799492 GGATGGCTTGAGCCCGGGAGGGG + Intronic
961176404 3:124838889-124838911 TAATGACTTGAGGCTGGGCGCGG - Intronic
961280966 3:125765856-125765878 GCAGGTCTTGGAGCTGGGAGAGG - Intergenic
961464444 3:127072791-127072813 GCCTGCCCTGAAGCTGGGTGAGG + Intergenic
961873429 3:130003729-130003751 GCAGGTCTTGGAGCTGGGAGAGG + Intergenic
962732698 3:138298619-138298641 GGATATCTTGTGGCTGGGAGTGG - Intronic
963895148 3:150677581-150677603 GGATCCCTTGAGCCTGGGGGTGG - Intronic
964766830 3:160187465-160187487 GTCTGCCTTGGGGATGGGAGTGG - Intergenic
965557537 3:170033598-170033620 GGTTGCCTTGAGGCTGGAGGTGG - Intergenic
966984031 3:185163618-185163640 GGAGGCCAGGAGGCTGGGAGTGG + Intergenic
967252462 3:187555102-187555124 GTTTGCCTTGGGGCTGAGAGAGG - Intergenic
967321548 3:188199800-188199822 GAATGTCTTGAACCTGGGAGGGG - Intronic
968025175 3:195436214-195436236 GGATCACTTGAGCCTGGGAGAGG - Intronic
968136047 3:196220211-196220233 GAAGGCTCTGAGGCTGGGAGTGG + Intronic
968297824 3:197591247-197591269 GAATCCCTTGAACCTGGGAGGGG - Intergenic
968498620 4:932824-932846 GCCTGCCTGGCTGCTGGGAGGGG - Intronic
968610948 4:1556760-1556782 GCGTGACCTGAGGCTGGGTGGGG - Intergenic
969016724 4:4108218-4108240 GCAGGTCTTGGAGCTGGGAGAGG + Intergenic
969080352 4:4612956-4612978 GAATCACTTGAGCCTGGGAGTGG + Intergenic
969275810 4:6135106-6135128 CCATGGCTTGAGAATGGGAGAGG - Intronic
969737242 4:9000097-9000119 GCAGGTCTTGGAGCTGGGAGAGG - Intergenic
969796438 4:9531685-9531707 GCAGGTCTTGGAGCTGGGAGAGG - Intergenic
970886073 4:20988810-20988832 CCCTGCCTTGAGGCAGAGAGGGG - Intronic
971762231 4:30781428-30781450 GAATGCCTTGGGGCCGGGTGCGG - Intronic
974671699 4:65038413-65038435 GCCTGCCTTGGGGTTGGGGGAGG + Intergenic
974756735 4:66218945-66218967 GGATCCCCTGAGGATGGGAGCGG - Intergenic
976213325 4:82692949-82692971 GCAAGCCTTGAGGCTGGGGCTGG + Intronic
979245656 4:118501148-118501170 GGCTGCCAGGAGGCTGGGAGAGG - Intergenic
979263242 4:118672109-118672131 TCATTCCGTGAGGCTGGGCGTGG + Intergenic
979436817 4:120703012-120703034 GCATGAATTGAGGCTGGGAATGG - Intronic
980908379 4:138971546-138971568 GCATCACCTGAGGCTGGAAGAGG + Intergenic
981930475 4:150184022-150184044 AAATGCCTTGAGGCTGGGTGTGG - Intronic
984474005 4:180214699-180214721 TCATCCCTTGGGGCTGGGCGTGG + Intergenic
984724432 4:183006998-183007020 GAATCCCTTGAACCTGGGAGGGG + Intergenic
984918584 4:184744494-184744516 GCATGCTTTGAGGGAGGGAGCGG - Intergenic
986077114 5:4349454-4349476 GCTAACCCTGAGGCTGGGAGAGG - Intergenic
986709823 5:10480579-10480601 GCATGCCTGGAGGATGGGGAGGG - Intergenic
987238528 5:15968824-15968846 GAATGCTTTGAACCTGGGAGGGG - Intergenic
988927258 5:36002248-36002270 GGATGGCTTGTGCCTGGGAGAGG - Intergenic
989453324 5:41612513-41612535 GCTTTTCTTGAGGCTGTGAGTGG + Intergenic
989945426 5:50221752-50221774 GCATGCTTTGAGGCTGATTGTGG - Intergenic
992434738 5:76745350-76745372 GAATTGCTTGAGCCTGGGAGGGG - Intergenic
992897495 5:81258188-81258210 AAATGCCTTGAGGCTGGGCGTGG - Intronic
992897502 5:81258224-81258246 AAATGCCTTGAGGCTGGGCGTGG - Intronic
995084929 5:108097498-108097520 TTATACCTTCAGGCTGGGAGTGG + Intronic
995403777 5:111770656-111770678 GAATGGCTTCAGCCTGGGAGGGG - Intronic
998035935 5:138915959-138915981 GAATCGCTTGAGCCTGGGAGAGG + Intronic
998367179 5:141639089-141639111 ACATGCAAGGAGGCTGGGAGAGG - Intronic
998383463 5:141742321-141742343 GAATGCCCTGAGGCTGGGTGGGG + Intergenic
1000153837 5:158530895-158530917 GAATCGCTTGAGCCTGGGAGGGG + Intergenic
1000164110 5:158630620-158630642 GCATGGGTAGAGGCAGGGAGTGG + Intergenic
1001332773 5:170773766-170773788 GCAAGAGTTCAGGCTGGGAGGGG + Intronic
1001483531 5:172104358-172104380 TCATGGCTGGAGGCTGGGTGAGG - Intronic
1001708615 5:173760273-173760295 CCATGTCTGGAGCCTGGGAGTGG - Intergenic
1002000245 5:176193092-176193114 GCACCCTTTGGGGCTGGGAGGGG - Intergenic
1002110449 5:176906364-176906386 GCAGGATATGAGGCTGGGAGAGG + Intronic
1002254095 5:177945892-177945914 GCACCCTTTGGGGCTGGGAGGGG + Intergenic
1002670812 5:180864994-180865016 GAATCCCTTGAACCTGGGAGGGG - Intergenic
1003065556 6:2901729-2901751 GCAGGCCTTGGGGATGGGTGTGG - Intronic
1003272662 6:4621051-4621073 GAATTCCTTGAGAGTGGGAGGGG + Intergenic
1004340543 6:14804106-14804128 TCATGCCTTAGGGCTTGGAGCGG - Intergenic
1004557289 6:16711703-16711725 GGATCACTTGAGCCTGGGAGGGG - Intronic
1004604849 6:17184382-17184404 GGATTGCTTGAGCCTGGGAGGGG + Intergenic
1005381548 6:25239957-25239979 GGATCCCTTGAGCCGGGGAGGGG - Intergenic
1005558695 6:27014401-27014423 GCCTGTCATGAGGCTGGGGGAGG + Intergenic
1006032455 6:31187097-31187119 GAATGGCTTGAACCTGGGAGGGG + Intergenic
1006082200 6:31574026-31574048 GGATGACTAGAGGCAGGGAGGGG + Exonic
1006118206 6:31786576-31786598 GAATCGCTTGAAGCTGGGAGGGG + Intronic
1006659544 6:35628803-35628825 GAATCACTTGAGCCTGGGAGTGG - Intronic
1008514121 6:52303474-52303496 GCATGCTTTGAGGGTGGTGGAGG + Intergenic
1009348300 6:62644894-62644916 GCCAGCCTTGAGGCTAGAAGGGG - Intergenic
1010295259 6:74188422-74188444 CAATGCCTTGTGGCTGGGCGCGG - Intergenic
1011909046 6:92411648-92411670 GCATGCCTTGAAGCTAGAGGAGG - Intergenic
1013334101 6:109137588-109137610 GTATGTTTTGAGGCTGGGAGCGG - Intronic
1016037943 6:139402612-139402634 GAATGGCGTGAGCCTGGGAGCGG - Intergenic
1017326035 6:153142344-153142366 GAATCGCTTGAGCCTGGGAGCGG + Intergenic
1017348678 6:153414758-153414780 GCATTGCTTGAGGCAGGGTGGGG + Intergenic
1017483926 6:154884963-154884985 GGATGACTTGAACCTGGGAGGGG + Intronic
1018138008 6:160796813-160796835 GCATTGCTTGAGGCAGGGTGGGG - Intergenic
1019008105 6:168820412-168820434 CTATGCATTGAGGCTGGGCGCGG + Intergenic
1019314279 7:377323-377345 CCCTGCCCTGAGGGTGGGAGTGG - Intergenic
1019407120 7:889624-889646 GCATGCATGGGGCCTGGGAGTGG + Intronic
1019597048 7:1863046-1863068 ACAGGCCTGGAGGCTGGGAGGGG + Intronic
1019730400 7:2626662-2626684 GCAGCTCTGGAGGCTGGGAGAGG - Intergenic
1020081024 7:5285609-5285631 ACCTGCCTAGAGGCTGGGAAGGG + Intronic
1020095885 7:5369055-5369077 GCATGAACCGAGGCTGGGAGCGG + Intronic
1020478495 7:8627549-8627571 GAATGCCAAGGGGCTGGGAGAGG + Intronic
1020492255 7:8801988-8802010 AAATGACTTGAGGCTGGGAGTGG + Intergenic
1020748499 7:12110174-12110196 GCATGCCTGCAGGCTGAGAAGGG + Intergenic
1023885111 7:44348828-44348850 GCAGGGCTTGTGGCTAGGAGGGG - Intergenic
1023906222 7:44523482-44523504 GCATGCCTTGAGGCTGGGAGTGG - Intronic
1024211398 7:47208846-47208868 GCATGCCTGGAGTGTTGGAGAGG - Intergenic
1024249493 7:47495550-47495572 GCCTGAGTTCAGGCTGGGAGAGG - Intronic
1025039592 7:55629487-55629509 GGGTGCCTTTTGGCTGGGAGGGG + Intergenic
1025197887 7:56946557-56946579 ACCTGCCTAGAGGCTGGGAAGGG - Intergenic
1025315289 7:58016706-58016728 GCATGCTTTGAGGCCTGGGGTGG + Intergenic
1025674061 7:63630378-63630400 ACCTGCCTAGAGGCTGGGAAGGG + Intergenic
1026018317 7:66689003-66689025 GAATTCCTTGAACCTGGGAGAGG + Intronic
1026347147 7:69483838-69483860 GGATGTCTTGAGCCTGGGAGGGG + Intergenic
1026967127 7:74447390-74447412 ATAAGACTTGAGGCTGGGAGTGG - Intergenic
1027143581 7:75678429-75678451 GAATCCCTTGAAGCTGGGAGAGG - Intronic
1027529757 7:79315675-79315697 GAATGTATTGAGGCTGGGGGAGG + Intronic
1029797567 7:102911049-102911071 GTATGCTTTTAGGCTGGGCGCGG - Intronic
1031067147 7:117117289-117117311 GCATGCCAGGAGCCTGTGAGAGG + Intronic
1031966326 7:128030829-128030851 GCTTGCCTTGAGGGTGGGTTGGG - Intronic
1032111204 7:129077395-129077417 GAATTGCTTGAGGCTGGGCGCGG + Intergenic
1032229181 7:130059641-130059663 GGATGCCCTGAGGAAGGGAGTGG - Intergenic
1032257079 7:130305975-130305997 GCATGCCATGTGGCTGGGCCTGG + Intronic
1032347815 7:131133439-131133461 GAATGGCTTGAACCTGGGAGCGG - Intronic
1033152607 7:138928575-138928597 GAATGCCTTTAGGCTGGGCATGG - Intronic
1033332249 7:140426390-140426412 GCAGGACTTCAGGCTAGGAGAGG + Intergenic
1034288074 7:149904005-149904027 GAATTGCTTGAGCCTGGGAGTGG - Intergenic
1034288450 7:149907341-149907363 GCGTGTCTTGGGGCTGGGAGTGG - Intergenic
1034460915 7:151197620-151197642 GCAGGCATTGTGGCTGGGAAAGG - Intronic
1034662682 7:152785639-152785661 GCGTGTCTTGGGGCTGGGAGTGG + Intronic
1034842188 7:154409054-154409076 GAATCACTTGAGCCTGGGAGGGG + Intronic
1035010466 7:155711310-155711332 GCATTCCCTGAGGCGGGGATGGG - Exonic
1035184691 7:157117181-157117203 GGATCACTTGAGGCTAGGAGTGG - Intergenic
1035208392 7:157309803-157309825 GCATTGCTTGTGGCTGGGTGTGG - Intergenic
1035366804 7:158353846-158353868 CCATGGGTTGAGGCAGGGAGAGG - Intronic
1036201273 8:6773358-6773380 GCTTGTCTGTAGGCTGGGAGTGG - Intergenic
1036307105 8:7610728-7610750 GCAGGTCTTGGAGCTGGGAGAGG - Intergenic
1036830405 8:12015770-12015792 GCAGGTCTTGGAGCTGGGAGAGG + Intergenic
1037801973 8:22040809-22040831 CCCTGCCTGGGGGCTGGGAGTGG + Intergenic
1037807875 8:22068478-22068500 GAATCCCTTGAGGCTGGGAAGGG + Intronic
1038132212 8:24745169-24745191 GCAGGCCTTGAGGTTGGAAGAGG - Intergenic
1038206403 8:25470847-25470869 GAATGGCTTGAACCTGGGAGAGG - Intronic
1039517833 8:38148140-38148162 GCTGGCCTTGAGGATGGCAGTGG + Intronic
1039738203 8:40355258-40355280 GGATCACTTGAGGCCGGGAGGGG + Intergenic
1039978614 8:42387980-42388002 GGATGGCTTGAGCCTGGGATGGG - Intergenic
1040428040 8:47308848-47308870 GCCTGCCTTGGGGCTGAGGGTGG + Intronic
1040548074 8:48417335-48417357 GCCTTCCCTTAGGCTGGGAGTGG + Intergenic
1040933193 8:52756532-52756554 GCATGCTTGGACACTGGGAGAGG - Intergenic
1040940314 8:52826193-52826215 GCAGGCAATGAGGCTGTGAGGGG - Intergenic
1041257257 8:55989894-55989916 GGATGTCTTGAAGCTGGGAGGGG + Intronic
1041283958 8:56241286-56241308 GGATAACTAGAGGCTGGGAGGGG + Intergenic
1042428118 8:68672815-68672837 GCACTGCTTGAGGTTGGGAGAGG - Intronic
1044572004 8:93730483-93730505 GTATACCTTGAGGATAGGAGAGG + Exonic
1044617267 8:94155302-94155324 TCATCCCCTGAGACTGGGAGTGG - Intronic
1044629646 8:94266085-94266107 GGATCACTTGAGCCTGGGAGTGG - Intergenic
1044682745 8:94798790-94798812 GAGTGTCTTGAGGCTGGGTGCGG + Intergenic
1045262986 8:100593539-100593561 GAATCCCTTGAGTCTGGGAGGGG - Intronic
1045945434 8:107789498-107789520 GCATGCTTGGATGCTGGTAGTGG - Intergenic
1047072641 8:121363420-121363442 GCATTCCTTGAGGTTAGGACAGG + Intergenic
1048429883 8:134360312-134360334 GCAAGCTTTGAGGCTGGAGGAGG + Intergenic
1048940141 8:139393414-139393436 GAATTCCTTGAACCTGGGAGGGG - Intergenic
1049246950 8:141567886-141567908 TCAGGCCTTGAAGCTGAGAGAGG - Intergenic
1049369791 8:142258810-142258832 GCATGCGTTCTGGCTGGGCGTGG - Intronic
1049393433 8:142383570-142383592 GCTGAGCTTGAGGCTGGGAGAGG - Intronic
1049981162 9:905043-905065 GCATGCCAAGAGGCAGGGTGGGG + Intronic
1050262141 9:3851850-3851872 ATATGGCTTGGGGCTGGGAGTGG + Intronic
1052867642 9:33474541-33474563 GAATCGCTTGAGCCTGGGAGAGG - Intergenic
1053466518 9:38312476-38312498 GCCTGCCTTGAGGCTTGAAGAGG + Intergenic
1054911118 9:70456152-70456174 GCGTGCCTTCAGGATGGCAGAGG - Intergenic
1055656038 9:78451333-78451355 GCATGCTTTAAAGGTGGGAGAGG + Intergenic
1055756014 9:79557787-79557809 GCTAGGCATGAGGCTGGGAGTGG - Intergenic
1056073494 9:83014386-83014408 GGATCACTTGAAGCTGGGAGAGG - Intronic
1056746631 9:89309562-89309584 GAATGGCTTGAACCTGGGAGGGG + Intergenic
1057131909 9:92659979-92660001 GCCTGCCTTCAGCTTGGGAGGGG - Intronic
1057282031 9:93720166-93720188 GCATGCCCTGGGGCTGTGGGAGG - Intergenic
1057330526 9:94110375-94110397 GGATGGCTTCAGGCTGGGAGCGG - Intergenic
1060600556 9:124874596-124874618 GGATTGCTTGAGCCTGGGAGAGG + Intronic
1060605936 9:124913941-124913963 GCAAGGCTAGAGGCTGGGTGAGG + Intronic
1060675915 9:125514347-125514369 CCCTGCCTCGAGGCTGGGGGAGG - Intronic
1060825082 9:126683184-126683206 GGAGGCCGGGAGGCTGGGAGAGG + Intronic
1061231341 9:129317699-129317721 GCCTCCCTTGCAGCTGGGAGTGG + Intergenic
1061978413 9:134085495-134085517 GCCTCCCTTGCAGCTGGGAGTGG + Intergenic
1062406092 9:136397426-136397448 GCAGGCCCTGGGTCTGGGAGAGG + Intronic
1203431613 Un_GL000195v1:95174-95196 GCATCCCAGGAGCCTGGGAGGGG + Intergenic
1203434891 Un_GL000195v1:129427-129449 GCATCCCAGGAGCCTGGGAGGGG - Intergenic
1185566557 X:1099555-1099577 GCCACCCTTGAGGCTGGGCGGGG - Intergenic
1186071179 X:5822533-5822555 GAATGGCTTGAACCTGGGAGGGG - Intergenic
1186654852 X:11601323-11601345 GCATGCCTGGTGGCAGGGAGAGG + Intronic
1187494351 X:19781681-19781703 GCAGGCAGTGAAGCTGGGAGTGG + Intronic
1187877199 X:23814300-23814322 TCATGCCTTGAGGAGGGGAAGGG - Intergenic
1187889573 X:23921784-23921806 GAATTGCTTGAGCCTGGGAGGGG - Intronic
1187907593 X:24082009-24082031 GGATGGCTTGAGCCCGGGAGTGG + Intergenic
1189303841 X:39972098-39972120 GCATGCCCAGAAGTTGGGAGAGG - Intergenic
1189434429 X:40979217-40979239 GAATCACTTGAGGCTGGGCGCGG + Intergenic
1190028323 X:46947105-46947127 GAATCACTTGAGCCTGGGAGGGG - Intronic
1190261309 X:48799241-48799263 GGATCGCTTGAGCCTGGGAGGGG - Intergenic
1190398779 X:50010952-50010974 GCATGTCCTGAGGGTGGGTGGGG + Intronic
1190418753 X:50206495-50206517 GGATCACTTGAGCCTGGGAGTGG + Intronic
1190641091 X:52483044-52483066 GCAAGCCTTGAGCCAGGGAATGG + Intergenic
1190646581 X:52529821-52529843 GCAAGCCTTGAGCCAGGGAATGG - Intergenic
1190886448 X:54534602-54534624 GGATGCATTGAGGCTCAGAGAGG + Intronic
1191812373 X:65203142-65203164 GCATGCCCTGAGGCAGAGAGGGG - Intergenic
1192430310 X:71107346-71107368 GGATGCAATGAGGGTGGGAGGGG - Intergenic
1193384508 X:80854659-80854681 GGGTGCCTTTTGGCTGGGAGGGG + Intergenic
1194868415 X:99097696-99097718 GAATCGCTTGAGCCTGGGAGGGG + Intergenic
1196439773 X:115707898-115707920 GGATCCCTTGAGCCTGGGTGGGG + Intergenic
1196709326 X:118746205-118746227 GGATCACTTGAGCCTGGGAGCGG - Intronic
1197538455 X:127723421-127723443 GAATCGCTTGAGCCTGGGAGGGG - Intergenic
1199444182 X:147901789-147901811 GAATTGCTTGAGGCTGGGTGTGG + Intergenic
1200307128 X:155038137-155038159 GGATGGCTTGAACCTGGGAGGGG + Intronic
1201274851 Y:12287404-12287426 GAGGGCCTAGAGGCTGGGAGGGG + Intergenic
1201411708 Y:13704771-13704793 GCATTGCTTGAACCTGGGAGGGG + Intronic