ID: 1023906223

View in Genome Browser
Species Human (GRCh38)
Location 7:44523487-44523509
Sequence CAGCTGCATGCCTTGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 820
Summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 777}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023906223_1023906228 23 Left 1023906223 7:44523487-44523509 CCCAGCCTCAAGGCATGCAGCTG 0: 1
1: 0
2: 0
3: 42
4: 777
Right 1023906228 7:44523533-44523555 GTACACAGCTTGCAGGAGCCAGG No data
1023906223_1023906227 16 Left 1023906223 7:44523487-44523509 CCCAGCCTCAAGGCATGCAGCTG 0: 1
1: 0
2: 0
3: 42
4: 777
Right 1023906227 7:44523526-44523548 GCAGCTTGTACACAGCTTGCAGG No data
1023906223_1023906229 27 Left 1023906223 7:44523487-44523509 CCCAGCCTCAAGGCATGCAGCTG 0: 1
1: 0
2: 0
3: 42
4: 777
Right 1023906229 7:44523537-44523559 ACAGCTTGCAGGAGCCAGGTAGG 0: 1
1: 2
2: 20
3: 48
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023906223 Original CRISPR CAGCTGCATGCCTTGAGGCT GGG (reversed) Intronic
900470756 1:2853829-2853851 CAGCTCCGTGCCATGAGCCTGGG + Intergenic
901089410 1:6631398-6631420 CGGGTGGATGTCTTGAGGCTAGG + Intronic
901468166 1:9436750-9436772 CAGCCGGATGGCTTGAGCCTGGG + Intergenic
901659453 1:10789293-10789315 CAGCAGGAGGCCTGGAGGCTGGG - Intronic
901878345 1:12179798-12179820 CAGATGCAGACATTGAGGCTTGG - Intronic
903353818 1:22734177-22734199 CAGCTGCCTGCATGCAGGCTGGG - Intronic
903356712 1:22752924-22752946 CAGGTGCATGCCATCATGCTGGG + Intronic
903479220 1:23640935-23640957 CAGCTGGATCACTTGAGGTTAGG - Intergenic
903544448 1:24114958-24114980 CAGCCGCATGACCTTAGGCTTGG - Intergenic
903580593 1:24367739-24367761 CAGATGGATCACTTGAGGCTAGG - Intronic
903695142 1:25200945-25200967 CAGGAGGATGGCTTGAGGCTGGG - Intergenic
904338558 1:29814357-29814379 CAGGTGCATGCCACCAGGCTGGG + Intergenic
904644037 1:31952447-31952469 CAGGTGGATCCCTTGAGGCCAGG + Intergenic
904683221 1:32243003-32243025 CAGGAGCATTGCTTGAGGCTTGG - Intergenic
904919584 1:33996595-33996617 CAGCTGCCTGCCTAGAGGGGTGG - Intronic
906216863 1:44046793-44046815 CAGCTGCATCACTTGAGGTCAGG + Intergenic
906301121 1:44682464-44682486 CAGCAGCATGGGTTGAGGCAAGG + Intronic
906384916 1:45359634-45359656 CAGGTGGATCCCCTGAGGCTAGG + Intronic
906521219 1:46468176-46468198 CAGGTGGATCACTTGAGGCTAGG + Intergenic
906927786 1:50137644-50137666 CAGCAGCATGTCTTGTGACTAGG - Intronic
907103753 1:51861470-51861492 CAGGTGCATGCCATGAGGCCTGG + Intronic
907114472 1:51956887-51956909 CAGCTGTATGGCTTCAGGCAAGG - Intronic
907308078 1:53524687-53524709 CAGATGCATGTGTTGAGGGTGGG + Intronic
907798375 1:57739965-57739987 CAGGTGGATCACTTGAGGCTGGG + Intronic
907800280 1:57758042-57758064 CAGCAGAATTGCTTGAGGCTAGG - Intronic
908140098 1:61175367-61175389 CAGGTGGATCCCTTGAGGCCAGG - Intronic
908147598 1:61263765-61263787 CAGCTGGATCACTTGAGGCCAGG + Intronic
908255372 1:62299198-62299220 CAGGTGCATGCCATGATGCCTGG + Intronic
909640663 1:77868452-77868474 CAGGTGGATGACTTGAAGCTGGG - Intronic
909654804 1:78019923-78019945 CAGATGGATCACTTGAGGCTAGG + Intronic
910108592 1:83657890-83657912 AAGCTGCACACCTTGAGTCTGGG + Intergenic
910108819 1:83660085-83660107 AAGCTGCACACCTTGAGTCTGGG - Intergenic
910138950 1:84005206-84005228 CAGGAGCATCCCTTGAGGCCAGG + Intergenic
910232109 1:84997495-84997517 CACCTCCATGCCTCGAGGCATGG + Intergenic
910300449 1:85701032-85701054 CAGGTGGATCCCTTGAGGCCAGG - Intronic
910965544 1:92804497-92804519 CAGATGGATTGCTTGAGGCTAGG + Intergenic
910994471 1:93089792-93089814 CAGGAACATCCCTTGAGGCTGGG - Intronic
912315443 1:108663767-108663789 CAGGAGGATGGCTTGAGGCTAGG + Intergenic
912488110 1:110045332-110045354 CAGGTGCATGCCTTGGTGCCCGG - Intronic
912610934 1:111043267-111043289 CAGGTGGATGGCTTGAGGCCAGG - Intergenic
912883494 1:113444143-113444165 CAACTGCCTGCCATGGGGCTGGG - Intronic
912983696 1:114403889-114403911 CAGGTGGATCACTTGAGGCTAGG - Intronic
913265770 1:117042321-117042343 CAGGTGGATCACTTGAGGCTAGG - Intergenic
913590444 1:120319719-120319741 CTGCTGTATGCCTTGAGAATGGG - Intergenic
913617740 1:120578644-120578666 CTGCTGTATGCCTTGAGAATGGG + Intergenic
914195338 1:145445542-145445564 GAGCTGGAGGCCGTGAGGCTGGG - Intergenic
914240799 1:145851426-145851448 CAGGTGAATCACTTGAGGCTGGG + Intronic
914445014 1:147742779-147742801 CAGGTGGATGGCTTGAGCCTAGG - Intergenic
914572532 1:148932328-148932350 CTGCTGTATGCCTTGAGAATGGG - Intronic
914600309 1:149197934-149197956 CTGCTGTATGCCTTGAGAATGGG + Intergenic
914734804 1:150405513-150405535 CAGCTGAATGTTTTGATGCTTGG + Intronic
914788423 1:150854467-150854489 GGGCTGCAGGCCTTGAGCCTGGG + Intronic
914792779 1:150893684-150893706 CAGCAGGATTGCTTGAGGCTAGG - Intergenic
914851522 1:151317899-151317921 CAGGAGGATGCCTTGAGCCTAGG - Intronic
914912001 1:151795147-151795169 CAGGTGGATGCCTTGAGCCCAGG - Intergenic
915013629 1:152713063-152713085 CTGGTGCAAGCCTTGGGGCTAGG + Intergenic
915094430 1:153450598-153450620 CAGGTGGATCACTTGAGGCTAGG - Intergenic
915100827 1:153498639-153498661 CAGCAGGATTGCTTGAGGCTGGG + Intergenic
915180582 1:154055621-154055643 CAGGAGCATGACTTGAGCCTAGG - Intronic
915669821 1:157479035-157479057 CTGAGGCATGCCTGGAGGCTGGG + Intergenic
915677720 1:157547244-157547266 CAGCAGGAGGCCCTGAGGCTGGG - Intronic
916058915 1:161085910-161085932 CAGGTGAATCCCTTGAGGCCAGG - Intronic
916174403 1:162025443-162025465 CAGGTGCATGCCACCAGGCTAGG - Intergenic
916186700 1:162140054-162140076 CAGGTGGATCACTTGAGGCTAGG - Intronic
916208131 1:162335263-162335285 CAGCTGCATGGCTCCAGGCCAGG - Intronic
916749257 1:167709437-167709459 CAGGTGGATAGCTTGAGGCTAGG + Intergenic
916850376 1:168697032-168697054 CAGGTGGATTGCTTGAGGCTAGG + Intronic
917097392 1:171412763-171412785 CAGGTGCATGGCTTGAGCTTAGG + Intergenic
917336289 1:173927327-173927349 CAGCTGGATCACTTGAGCCTAGG - Intergenic
917823820 1:178794950-178794972 CAGGTGGATCACTTGAGGCTAGG + Intronic
918181299 1:182087621-182087643 CAGCTGCAGCCCCTGAGGGTGGG + Intergenic
919459700 1:197862181-197862203 CAGGTGGATCACTTGAGGCTAGG - Intergenic
920021193 1:202958015-202958037 CGGCTGGATGCCTGGAGGCCAGG + Intronic
920264881 1:204714526-204714548 AAGCTGCCAGCCTTGTGGCTGGG - Intergenic
920924185 1:210326711-210326733 CAGGTGCATCACTTGAGGCCAGG + Intergenic
922120717 1:222664968-222664990 CAGGTGGATCCCTTGAGCCTAGG + Intronic
922272537 1:224047247-224047269 CAGATGGATCCCTTGAGGCCAGG + Intergenic
922856107 1:228775905-228775927 CAGGTGGATCACTTGAGGCTAGG + Intergenic
923238424 1:232057449-232057471 CAGCCACTTGCCTTGGGGCTCGG + Intergenic
923360747 1:233208340-233208362 TAGTTGGATGCTTTGAGGCTTGG + Intronic
923725245 1:236499852-236499874 CAGGTGGATCGCTTGAGGCTGGG + Intergenic
923741024 1:236655103-236655125 CAGCTGCATGCCATCATGCTCGG + Intergenic
924535234 1:244930004-244930026 CAGGTGCATCACTTGAGGTTAGG - Intergenic
924535907 1:244935579-244935601 CAGGTGCATCACTTGAGGTTAGG + Intergenic
1063398475 10:5716685-5716707 CAGGTGTATCCCTTGAGGCCAGG + Intronic
1063438946 10:6056522-6056544 CAGATGGATGGCTTGAGGCTCGG + Intronic
1063614082 10:7587471-7587493 CAGCTGTCACCCTTGAGGCTGGG + Intronic
1064054521 10:12086361-12086383 CAGGTGCATGCCATGATGCCTGG + Intronic
1064201498 10:13288653-13288675 CAGATGGATGGCTTGAGCCTGGG + Intronic
1064390278 10:14936119-14936141 CAGGTGCATCACTTGAGGCCAGG - Intronic
1064440825 10:15351823-15351845 CAGGTGGATCCCTTGAGCCTGGG + Intronic
1064542472 10:16418865-16418887 CAGGTGCATGACTTGAGGTCAGG + Intergenic
1065049177 10:21773295-21773317 TAGCTGCATTCCTTGAGTCTTGG + Intronic
1066153805 10:32653234-32653256 CAGCTGATTCCCTTGGGGCTGGG + Intronic
1066640267 10:37548420-37548442 CAGGTGGATTCCTTGAGCCTAGG - Intergenic
1067128398 10:43539957-43539979 CAGGTGGATGGCTTGAGGCTAGG - Intergenic
1067228497 10:44390704-44390726 GAGCTGCATGCCAGGAAGCTGGG + Intergenic
1067294653 10:44968384-44968406 CAGCTCCAGGCCTTGCTGCTGGG + Intronic
1067308383 10:45089213-45089235 CAGGAGGATCCCTTGAGGCTAGG - Intergenic
1067659757 10:48225573-48225595 CAGGTGCATCCCAGGAGGCTGGG - Intronic
1067715114 10:48684923-48684945 CAGCTGCAGCCCCTCAGGCTCGG - Intronic
1068434571 10:56973793-56973815 CAGTTGCAAGGGTTGAGGCTTGG - Intergenic
1068438183 10:57017702-57017724 CAGCTGGTTGCCTTGAAGGTGGG + Intergenic
1068488972 10:57697801-57697823 CAGGTGGATGACTTGAGGTTAGG + Intergenic
1068499144 10:57821053-57821075 AAGCTGCAGGCCTTGAGATTGGG - Intergenic
1068967829 10:62931585-62931607 CAGAAGAATCCCTTGAGGCTAGG + Intergenic
1069232895 10:66033984-66034006 CAGATGCAGGCATTGAGGCATGG - Intronic
1069477108 10:68744395-68744417 TAGGTGGATGGCTTGAGGCTAGG + Intronic
1069526648 10:69178106-69178128 CAGCTGGATCACTTGAGGCCAGG + Intergenic
1069837732 10:71319635-71319657 CAGCTGCGGGGCCTGAGGCTGGG + Intronic
1070255008 10:74806405-74806427 CAGGTGGATCACTTGAGGCTAGG + Intergenic
1072133291 10:92517733-92517755 CAGGTGCATCACTTGAGGCCAGG + Intronic
1072140232 10:92583171-92583193 CAGCTGGATCACTTGAGGCCAGG + Intergenic
1072351331 10:94560465-94560487 CAGATGGATTCCTTGAGGCAAGG + Intronic
1073195193 10:101684549-101684571 CAGCACCAGGCCTTGGGGCTTGG + Intronic
1073271169 10:102265448-102265470 CAGCAGGATTACTTGAGGCTGGG + Intronic
1074456593 10:113600971-113600993 CAGCTGTATGCAGAGAGGCTGGG + Intronic
1074490289 10:113933834-113933856 CAGGTGCATCGCTTGAGGCCAGG - Intergenic
1074533128 10:114310591-114310613 CACATGCAGGCCTTGGGGCTGGG - Intronic
1074656615 10:115596331-115596353 CAGGTGGATCCCTTGAGGTTGGG - Intronic
1075102960 10:119518931-119518953 CAGGTGGATCACTTGAGGCTGGG - Intronic
1075116800 10:119633604-119633626 CAGGAGCATTCCTTGAGGCCAGG + Intergenic
1075149330 10:119912866-119912888 CAGGTGGATGACTTGAGGCCAGG - Intronic
1075346131 10:121683009-121683031 CGGCTGGATTGCTTGAGGCTAGG + Intergenic
1076546147 10:131246748-131246770 CACCTTCCAGCCTTGAGGCTGGG + Intronic
1076894042 10:133300702-133300724 CAGGTGGATGGCTTGAGCCTGGG - Intronic
1077557416 11:3232270-3232292 CAGCTGGATGCCATGTGACTCGG - Exonic
1078381759 11:10848669-10848691 CAGGAGAATGGCTTGAGGCTAGG + Intronic
1079226066 11:18605903-18605925 CAGGTGGATCACTTGAGGCTGGG - Intergenic
1079317239 11:19419056-19419078 GAGATGTATGCCTTGAGTCTGGG + Intronic
1079590256 11:22174885-22174907 CAGCTGCCTGCCTTCAGGGAAGG - Intergenic
1081567799 11:44270554-44270576 CATCTGCAGGTCCTGAGGCTTGG + Intronic
1081836513 11:46159960-46159982 CAGGTGCAGGGCTTGAGGCTGGG + Intergenic
1082025503 11:47568446-47568468 CAGGAGGATGGCTTGAGGCTAGG + Intronic
1083134697 11:60661277-60661299 CAGGAGTATGCCTTGAGGCCAGG - Intergenic
1083324064 11:61864620-61864642 CAGGTGGATCACTTGAGGCTAGG - Intronic
1083842261 11:65311226-65311248 CAGCTGAGTGCCTTGAGCCCCGG - Intergenic
1083861119 11:65420686-65420708 CAGCAGGATCCCTTGAGCCTAGG - Intergenic
1083948825 11:65942428-65942450 CAGGTGGATGGCTTGAGGCCAGG + Intergenic
1084078071 11:66797730-66797752 CAGGTGGATCACTTGAGGCTAGG - Intronic
1084299291 11:68235884-68235906 CAGCTGCGTGCCATAGGGCTGGG + Intergenic
1084333399 11:68443223-68443245 CAGCTGCAAGCCATCACGCTGGG - Intronic
1084586528 11:70065756-70065778 CAGGTGAAGGCCTTGAGGCTGGG - Intergenic
1084897302 11:72282738-72282760 CAGCTGCCTGCCATGGGGCTGGG + Intergenic
1084961015 11:72716768-72716790 CAGCTGCATGGGCTGTGGCTCGG + Intronic
1085141838 11:74151552-74151574 CAGCTGGATCACTTGAGGCCAGG - Intronic
1085893857 11:80613244-80613266 CAGGTGCATCACTTGAGGCCAGG + Intergenic
1086248721 11:84787869-84787891 CAGGTGGATCACTTGAGGCTAGG + Intronic
1087228943 11:95637745-95637767 CAGGTGGATGGCTTGAGCCTAGG - Intergenic
1087713478 11:101582254-101582276 CCGCAGCAGGGCTTGAGGCTGGG + Intronic
1088327219 11:108613391-108613413 CAGGTGCATGCCATGACACTTGG + Intergenic
1088455484 11:110028775-110028797 CAACTACATGACTTGAGGTTGGG - Intergenic
1088525912 11:110754475-110754497 CAGGTGCATCACTTGAGGCCAGG + Intergenic
1088881788 11:113978596-113978618 CAGGTGGATGGCTTGAGGCCAGG - Intronic
1089145820 11:116329066-116329088 CAGCTCCAGGCCTAGAGGCCGGG + Intergenic
1089234829 11:117014834-117014856 CAGGTGAATGGCTTGAGCCTAGG + Intronic
1089595581 11:119577310-119577332 CAGGTGGATCACTTGAGGCTAGG + Intergenic
1089744392 11:120606882-120606904 AATCTGCATGTTTTGAGGCTGGG + Intronic
1089936800 11:122372477-122372499 CAGCTGCATGAATTCAGGCATGG - Intergenic
1090050616 11:123375329-123375351 CAGAAGGATGCCTTGAGGCCAGG + Intergenic
1090194916 11:124806680-124806702 CAGGTGGATCCCTTGAGGCCAGG + Intergenic
1090341477 11:126025060-126025082 CAGGTGCATGCCACCAGGCTCGG - Intronic
1090390575 11:126384721-126384743 CAGCAGCATCTCCTGAGGCTGGG + Intronic
1091271018 11:134312022-134312044 CAGGTGCATCACTTGAGGCCAGG - Intronic
1091745504 12:2989665-2989687 CAGGTGGATGGCTTGAGGCCAGG - Intronic
1091812488 12:3411041-3411063 AATCGGCATGCTTTGAGGCTTGG + Intronic
1092346143 12:7716008-7716030 CAGCTGGATCACTTGAGCCTGGG + Intronic
1092358290 12:7815181-7815203 CAGGTGGATCCCTTGAGGCCAGG + Intronic
1094139434 12:27165486-27165508 CAGGTGGATCACTTGAGGCTGGG - Intergenic
1094478345 12:30859744-30859766 CAGCTGAAGGCAGTGAGGCTGGG + Intergenic
1094600631 12:31906174-31906196 CAGGTGCATGCCATCACGCTCGG + Intergenic
1095263477 12:40125846-40125868 CAGGAGGATGGCTTGAGGCTAGG - Intergenic
1096118600 12:49071156-49071178 CAGGTGGATCACTTGAGGCTAGG - Intergenic
1096452765 12:51758050-51758072 CAGGAGCATGGCTTGAGGCCAGG + Intronic
1096737106 12:53664130-53664152 CGGGTGCATCACTTGAGGCTGGG + Intronic
1096980348 12:55725079-55725101 GAGCTGGATCCCTTGAGGATTGG + Intergenic
1097316572 12:58177669-58177691 CAGATGGATGGCTTGAGCCTAGG - Intergenic
1098299662 12:69041035-69041057 CAGGAGGATGACTTGAGGCTAGG - Intergenic
1098917287 12:76270665-76270687 CAGGTGGATTGCTTGAGGCTAGG - Intergenic
1099335149 12:81347020-81347042 CAGCAGGATTCCTTGAGCCTAGG - Intronic
1099853860 12:88139869-88139891 CAGGTGCATGCCATCATGCTTGG + Intronic
1100403675 12:94253904-94253926 TGGGAGCATGCCTTGAGGCTAGG - Intronic
1100625364 12:96325879-96325901 CAGGTGCATGCCATCATGCTTGG - Intronic
1100988590 12:100228385-100228407 CAGGTGGATGGCTTGAGCCTGGG + Intronic
1101008734 12:100428061-100428083 CAGGTGGATGGCTTGAGGCCGGG + Intergenic
1101099978 12:101381789-101381811 CAGGTGCATCACTTGAGGCCAGG + Intronic
1101303821 12:103507440-103507462 CAGGAGGATGGCTTGAGGCTAGG + Intergenic
1101389207 12:104284946-104284968 CAGACGGATCCCTTGAGGCTAGG + Intronic
1101617182 12:106349724-106349746 CAGGTGCATCACTTGAGGCCAGG + Intergenic
1101856504 12:108448003-108448025 CAGGTGGATCACTTGAGGCTGGG - Intergenic
1101917781 12:108909371-108909393 CAGGTGCCCGCCTTGATGCTTGG - Intergenic
1102307413 12:111815852-111815874 CAGCAGGATGACTTGAGGCCAGG - Intergenic
1102473147 12:113171372-113171394 CAGATGCATCACTTGAGGTTAGG + Intronic
1102608137 12:114086519-114086541 CAGATGGATTGCTTGAGGCTGGG - Intergenic
1102684371 12:114713160-114713182 CAGGTGGATCACTTGAGGCTAGG - Intergenic
1102826164 12:115949529-115949551 TAGCTGCATGCCCTGAACCTTGG - Intergenic
1102946225 12:116990920-116990942 CAGGAGGATGGCTTGAGGCTGGG + Intronic
1103305855 12:119963463-119963485 CAGCAGCATTCCCAGAGGCTAGG + Intergenic
1103767677 12:123293289-123293311 CAGGTGCATCACTTGAGGCCAGG - Exonic
1104209094 12:126670048-126670070 CAGGTGGATAACTTGAGGCTTGG - Intergenic
1104337127 12:127909607-127909629 CAGGAGGATGGCTTGAGGCTAGG + Intergenic
1104501156 12:129286818-129286840 CAGGTGGATGGCTTGAGGCTGGG + Intronic
1104590483 12:130080763-130080785 CAGGTGGATGACTTGAGGTTGGG + Intergenic
1106100735 13:26693881-26693903 CAGCGACATGCCTTGAGGTCGGG + Intergenic
1106261625 13:28072621-28072643 CAGCTGAATCACTTGAGGCCAGG - Intronic
1106376415 13:29192944-29192966 CAGTTGGATGCCTAGAGGGTTGG + Intronic
1106649417 13:31673712-31673734 CAGCTGCCTGCCACAAGGCTTGG + Intergenic
1106741146 13:32643301-32643323 TAGCTGCATGACTTCAGGTTAGG - Intronic
1106998257 13:35513376-35513398 CAGGTGGATCCCTTGAGGCCAGG - Intronic
1107612979 13:42134773-42134795 CAGGTGGATCGCTTGAGGCTAGG + Intronic
1107959309 13:45544447-45544469 CAGGTGGATCCCTTGAGCCTAGG - Intronic
1108110322 13:47064586-47064608 TAGCTGCCTGCCATGGGGCTGGG + Intergenic
1108362984 13:49684441-49684463 CAGCTGGATCACTTGAGGCCAGG + Intronic
1109253580 13:60050416-60050438 CAGCTGCCTGCCTAGAGGATCGG - Intronic
1109715399 13:66215411-66215433 CAGGTGAATCCCTTGAGGTTAGG - Intergenic
1110201498 13:72855419-72855441 CAGGTGGATAACTTGAGGCTAGG + Intronic
1110395089 13:75020462-75020484 CAGCTGGAAGGCTTGAAGCTTGG - Intergenic
1110616735 13:77550156-77550178 CAGGTGGATGGCTTGAGGCCAGG + Intronic
1111925805 13:94462278-94462300 CAGGTGGATCCCTTGAGGCCAGG + Intronic
1112158015 13:96838492-96838514 CAACTGCATGTCTTCAGGCTGGG + Exonic
1112480673 13:99772467-99772489 CAGATGGATCCCTTGAGCCTAGG + Intronic
1113099412 13:106701191-106701213 CAGGTGCATGCCATCAGGCCTGG + Intergenic
1114276675 14:21152820-21152842 CAGGTGGATTGCTTGAGGCTAGG - Intergenic
1115232045 14:31171182-31171204 CAGGTGGATCACTTGAGGCTAGG + Intronic
1115386725 14:32806447-32806469 CAGGTGGATTGCTTGAGGCTAGG + Intronic
1115644377 14:35357704-35357726 CAGGTGGATCCCTTGAGCCTAGG - Intergenic
1115671931 14:35622869-35622891 CAGGTGAATCACTTGAGGCTAGG + Intronic
1116955182 14:50915991-50916013 CAGCTGCTTGCCCTGAAGGTGGG + Intronic
1117386976 14:55225132-55225154 CAGGTGCATGCCATGACCCTTGG - Intergenic
1117925229 14:60772167-60772189 CAGGAGCATTGCTTGAGGCTAGG + Intronic
1118274040 14:64369864-64369886 CAGATGCATGCCTCCATGCTTGG - Intergenic
1118622531 14:67626685-67626707 CAGGTGGATCACTTGAGGCTAGG - Intronic
1118856855 14:69629709-69629731 CAGCTTCTTGCCGTGAGGCTGGG + Intronic
1119080753 14:71691362-71691384 CTGGTGCATGGCTTGAGTCTAGG + Intronic
1119083281 14:71717040-71717062 CAGGTGCATGCCTTCACGCCCGG + Intronic
1119216166 14:72870845-72870867 CAGGTGGATGGCTTGAGGCCAGG + Intronic
1119310440 14:73641918-73641940 CAGGAGGATGGCTTGAGGCTGGG - Intergenic
1119313076 14:73667232-73667254 CAGGTGGATCACTTGAGGCTAGG + Intronic
1119491522 14:75038125-75038147 CAGGTGGATGGCTTGAGGCCAGG - Intronic
1119492300 14:75045949-75045971 CAGGTGGATCACTTGAGGCTAGG + Intronic
1119689767 14:76662431-76662453 CAGGTGGATCCCTTGAGGTTAGG + Intergenic
1119724493 14:76913894-76913916 CTTCTGCTGGCCTTGAGGCTAGG - Intergenic
1119797252 14:77410028-77410050 CAGCTGCATCACTTGAGGCCAGG - Intronic
1119807722 14:77493136-77493158 CAGGTGCATGCCATCAAGCTTGG + Intronic
1120832023 14:89005851-89005873 CAGATGGATCCCTTGAGGCCAGG + Intergenic
1121242919 14:92442842-92442864 CAGATGCATGCCCTGAAGCGTGG + Intronic
1121251947 14:92506062-92506084 CAGCTGCCCACCTTGAGGCTTGG + Intergenic
1121286813 14:92742512-92742534 CAGGTGCATCACTTGAGGCCAGG - Intronic
1122000647 14:98649004-98649026 CAGCTGCATGGCTTCTGTCTGGG - Intergenic
1124004115 15:25782940-25782962 CAGCAGGATTGCTTGAGGCTGGG + Intronic
1124050626 15:26194195-26194217 CAGGAGGATGCCTTGAGCCTCGG + Intergenic
1125475883 15:40047750-40047772 CACCTGCAAGCATTCAGGCTGGG + Intergenic
1125787842 15:42337832-42337854 CAGGTGGATCACTTGAGGCTAGG + Intronic
1125835779 15:42749463-42749485 CAGCTGCCTGCCATGGGGCCGGG - Intronic
1126156014 15:45566287-45566309 CAGATGGATGCCTTGAGCTTAGG + Intergenic
1126601718 15:50434845-50434867 CAGGTGGATTCCTTGAGGTTGGG - Intronic
1126790819 15:52219507-52219529 CAGTTGGTTGCCTTCAGGCTTGG - Intronic
1127133665 15:55896409-55896431 CAGGTGCATCCCTTGAGGCCAGG - Intronic
1127200166 15:56637406-56637428 CAGGAGGATCCCTTGAGGCTGGG - Intronic
1127243992 15:57151206-57151228 CAGGAGAATGGCTTGAGGCTGGG - Intronic
1128075101 15:64820985-64821007 CTACTGCAGGCCGTGAGGCTAGG - Exonic
1128272169 15:66319885-66319907 CAGGTGGATCACTTGAGGCTAGG + Intronic
1128670065 15:69567944-69567966 CAGGTGGATGACTTGAGGCCAGG + Intergenic
1129307192 15:74674334-74674356 CAGCAGTATCACTTGAGGCTAGG - Intronic
1129547288 15:76409928-76409950 CAGGTGCATGCCATCAGGCCTGG + Intronic
1129585325 15:76857203-76857225 CAGGTGGATCCCTTGAGGCCAGG + Intronic
1129586631 15:76874119-76874141 CAGATGGATCACTTGAGGCTAGG - Intronic
1129814413 15:78539614-78539636 CAGGAGGATGGCTTGAGGCTAGG - Intergenic
1130669096 15:85894548-85894570 CAGGTGCATCACTTGGGGCTAGG - Intergenic
1130940353 15:88503034-88503056 CAGGTGGATCACTTGAGGCTAGG + Intergenic
1131006817 15:88985193-88985215 CAGGAGGATGCCTTGAGGCCAGG + Intergenic
1131585194 15:93685019-93685041 CAGCTGCAGCCCATGTGGCTAGG - Intergenic
1131842046 15:96447869-96447891 CAGGTGGATGGCTTGAGCCTAGG - Intergenic
1132004369 15:98213253-98213275 CAGATGCATGCCACCAGGCTCGG - Intergenic
1132472504 16:113552-113574 CAGCTGCATGCCTCCACCCTTGG - Intronic
1132521295 16:390810-390832 CAGGTGGATCCCTTGAGGCCAGG - Intergenic
1132794060 16:1709918-1709940 CAGCTGCCTGCCATGAGCCTGGG - Intronic
1133365516 16:5206056-5206078 CAGGTGGATTCCTTGAGGCCAGG + Intergenic
1133481147 16:6171962-6171984 CAGGTGCATGCCTCCACGCTTGG + Intronic
1133983248 16:10649336-10649358 CAGGAGGATGGCTTGAGGCTAGG - Intronic
1134491810 16:14701330-14701352 CAGGTGCATCCCTTGAGGTCAGG + Intergenic
1134497191 16:14740448-14740470 CAGGTGCATCCCTTGAGGTCAGG + Intronic
1134558297 16:15185229-15185251 CAGGTGGATCCCTTGAGGCCAGG - Intergenic
1134918829 16:18096832-18096854 CAGGTGGATCCCTTGAGGCCAGG - Intergenic
1135117338 16:19734932-19734954 CTTCTGCATGCCTTGGGCCTTGG + Intronic
1135481552 16:22824857-22824879 CAGCAGCAAGCACTGAGGCTAGG - Intronic
1135675008 16:24407779-24407801 CAGCTGCATGCCACCAGGCATGG + Intergenic
1135967895 16:27051175-27051197 CTGCTGCATCCCTAGTGGCTAGG - Intergenic
1136023304 16:27453878-27453900 CAGGCGGATCCCTTGAGGCTAGG + Intergenic
1136316471 16:29457518-29457540 CAGCTCCATCCCATGAGGCAGGG - Intronic
1136431048 16:30196860-30196882 CAGCTCCATCCCATGAGGCAGGG - Intronic
1136539215 16:30919526-30919548 CAGCTGGATCACTTGAGGCCAGG - Intergenic
1136993487 16:35172068-35172090 CTCCTGCATGCCTTGATGTTGGG - Intergenic
1137408333 16:48207436-48207458 CAGGTGGATGACTTGAGGCCAGG + Intronic
1137477095 16:48818369-48818391 CAGCTTCGGGCCCTGAGGCTGGG + Intergenic
1137575081 16:49594094-49594116 CAGCTGCCTGCCTTTCAGCTGGG + Intronic
1137678317 16:50315588-50315610 CATCTGCATGCCTTTGGGATTGG - Exonic
1137846581 16:51695839-51695861 CAGATGCATGCCTTGAGCCCAGG + Intergenic
1138030172 16:53553500-53553522 CAGGTGCATCCCTTGAGGCCAGG + Intergenic
1138052557 16:53795530-53795552 CAGGTGGATGGCTTGAGCCTAGG - Intronic
1138293379 16:55867065-55867087 CAGCTGTGTGCCATGAGGGTGGG + Intronic
1138425554 16:56929854-56929876 CAGCTGGATCACTTGAGGCGAGG + Intergenic
1138462822 16:57162435-57162457 CAGGTGGATCACTTGAGGCTAGG + Intronic
1138653317 16:58474268-58474290 CAGGTGCACGGCTTGAGGCCAGG - Intronic
1140742048 16:77950179-77950201 CAGGTGGATGCCTTGAGGTCAGG + Intronic
1140785919 16:78342021-78342043 CAGCAGAATGGCTTGAGCCTGGG + Intronic
1141708814 16:85685576-85685598 CAGGAGGATGACTTGAGGCTGGG + Intronic
1141866759 16:86755627-86755649 CAGCTGCGTGACTTCAGGCCCGG - Intergenic
1142193892 16:88730657-88730679 CAGGAGCATCCCTTGAGGCCAGG - Intronic
1142208364 16:88794851-88794873 CAGGTGGATTGCTTGAGGCTAGG - Intergenic
1142698380 17:1645687-1645709 GAGCTGCCTGCCATGGGGCTGGG - Exonic
1142868666 17:2806909-2806931 CAGGTGGATCGCTTGAGGCTAGG - Intronic
1143075015 17:4334152-4334174 CAGGTGGATGGCTTGAGCCTAGG - Intronic
1143398726 17:6625927-6625949 CAGGTGCATCACTTGAGGCCAGG - Intronic
1145048011 17:19634362-19634384 CAGGTGGATGGCTTGAGCCTAGG + Intergenic
1145789136 17:27614027-27614049 CAGATGGATCCCTTGAGGCCAGG - Intronic
1146385545 17:32369223-32369245 TAGATGCATGCCTTTATGCTTGG + Intronic
1147012317 17:37460139-37460161 CAGTAGGATGCCTTGAGTCTAGG - Intronic
1147706175 17:42426267-42426289 CAGGTGGATCCCTTGAGCCTAGG - Intergenic
1147956105 17:44135784-44135806 CAGGTGGATCCCTTGAGGTTAGG - Intergenic
1148008117 17:44451318-44451340 CAGGTGGATCACTTGAGGCTAGG - Intronic
1148031638 17:44625762-44625784 CAGGTGGATCACTTGAGGCTAGG - Intergenic
1148485028 17:47985250-47985272 CAGGAGGATCCCTTGAGGCTAGG - Intergenic
1148526950 17:48348110-48348132 CAGGTGGATGGCTTGAGCCTAGG + Intronic
1148622747 17:49046488-49046510 CATCTGCCTGCCTCTAGGCTAGG + Intronic
1148761383 17:50003425-50003447 CAGGTGCATCGCTTGAGGATAGG - Intergenic
1148966864 17:51443044-51443066 AAGCTGCATGCTATCAGGCTCGG - Intergenic
1149460504 17:56826179-56826201 CAGGTGGATCCCTTGAGGCCAGG - Intronic
1149719900 17:58833051-58833073 CAGGTGAATCACTTGAGGCTGGG - Intronic
1149728633 17:58923056-58923078 CAGCTGGATCACTTGAGGCCTGG + Intronic
1149886913 17:60349350-60349372 CAGGTGGATCCCTTGAGGCCAGG + Intronic
1150649137 17:66998626-66998648 GAGCTGCCTGCCTGGGGGCTTGG - Intronic
1150701957 17:67454960-67454982 CAGCTGCATGCCACCAGGCCTGG + Intronic
1150895436 17:69204899-69204921 CAGCTAAATGGCTTGAGGCCAGG + Intronic
1150900819 17:69275069-69275091 CAGCTGGATCACTTGAGGCCAGG - Intronic
1151461494 17:74256874-74256896 CAGGTGCATCACTTGAGGCCAGG - Intronic
1151514522 17:74583979-74584001 CAGGTGGATCACTTGAGGCTAGG - Intronic
1151741459 17:75985373-75985395 CAGGTGGATCCCTTGAGACTAGG - Intronic
1151781886 17:76252155-76252177 CAGCTGCCTGCCTTCAGGGCTGG + Intergenic
1152815065 17:82402965-82402987 CAGCAGGATGGCTTGAGCCTGGG + Intronic
1153280403 18:3409458-3409480 CAGCTGCATGCCTCCATGCCCGG - Intergenic
1153832707 18:8937275-8937297 CAGCTGCATGCCACGTGACTCGG + Intergenic
1153903266 18:9637696-9637718 CAGGAGGATGACTTGAGGCTAGG + Intergenic
1154245490 18:12693329-12693351 CAGGTGGATTGCTTGAGGCTGGG + Intronic
1154971966 18:21418750-21418772 CAGGTGGATGACTTGAGGCCAGG - Intronic
1155002094 18:21697520-21697542 CAGGTGCATGCCATGATGCCCGG + Intronic
1155067095 18:22277290-22277312 CAGGTGGATCACTTGAGGCTAGG + Intergenic
1155716261 18:28947631-28947653 CAGGTGGATCCCTTGAGGCTAGG + Intergenic
1155749527 18:29403708-29403730 CAGCTTCCTACCTTAAGGCTCGG + Intergenic
1155959550 18:31982630-31982652 CAGGAGAATGGCTTGAGGCTGGG - Intergenic
1156123881 18:33879536-33879558 CAGGTGCATGCCTCCATGCTGGG - Intronic
1156386486 18:36609836-36609858 CAGGTGGATCACTTGAGGCTAGG - Intronic
1157263313 18:46195027-46195049 CAGCTGAATCACTTGAGGCCAGG - Intronic
1158698371 18:59723335-59723357 CAGGTGGATCCCTTGAGGCCAGG + Intergenic
1159047208 18:63380681-63380703 CAGGTGGATCACTTGAGGCTAGG - Intergenic
1159869733 18:73746784-73746806 CAGCAGCATGGCCTGATGCTTGG - Intergenic
1160203682 18:76815801-76815823 CAGGCGAATCCCTTGAGGCTAGG + Intronic
1160291137 18:77594787-77594809 CAGGAGGATGACTTGAGGCTAGG + Intergenic
1161025755 19:2036002-2036024 CAGCTGGATTACTTGAGGCCAGG + Intergenic
1161043509 19:2122356-2122378 CAGCTGTGTGCCCTGTGGCTGGG - Intronic
1161074830 19:2280575-2280597 CAGGTGGATCCCTTGAGGCCAGG - Intronic
1161752384 19:6107522-6107544 CAGGTGAATCCCTTGAGCCTGGG + Intronic
1161755693 19:6131769-6131791 CAGCAACATTCCTAGAGGCTGGG + Intronic
1161968565 19:7562483-7562505 CAGGTGGATGGCTTGAGGCCAGG - Intergenic
1161972177 19:7588611-7588633 CAGGAGCATCCCTTGAGCCTGGG - Intergenic
1162089960 19:8272856-8272878 CAGGTGGATGACTTGAGGCTAGG + Intronic
1162092191 19:8287720-8287742 CAGGTGGATGACTTGAGGCTAGG + Intronic
1162455033 19:10778422-10778444 CAGGAGGATGCCTTGAGGCTGGG + Intronic
1162493012 19:11005690-11005712 GAGCTGCAGGCCATGAGGCTTGG - Intronic
1162788590 19:13051570-13051592 AACCTGCCTGACTTGAGGCTTGG - Intronic
1162869033 19:13571797-13571819 CAGGAGGATGGCTTGAGGCTGGG + Intronic
1163135935 19:15311061-15311083 CAGGTGGATCCCTTGAGGCCAGG + Intronic
1163519294 19:17782429-17782451 CAGCTGGATTACTTGAGGCCAGG - Intronic
1163524842 19:17814541-17814563 CAGGTGGATCCCTTGAGGCCAGG - Intergenic
1163530428 19:17845552-17845574 CAGGTGGATCACTTGAGGCTAGG + Intronic
1163542588 19:17919879-17919901 CAGGAGGATCCCTTGAGGCTAGG - Intergenic
1163643846 19:18477121-18477143 CAGCTGTTTTCCTTTAGGCTTGG - Intronic
1163938530 19:20472515-20472537 CAGGTGCATGCCAGGAGGCCTGG + Intergenic
1164497130 19:28776770-28776792 CAGGTGGATCACTTGAGGCTAGG + Intergenic
1164887965 19:31799414-31799436 CAGCTGAATCACTTGAGGCCAGG + Intergenic
1165335801 19:35168833-35168855 CAGGTGGATCCCTTGAGGCCAGG + Intronic
1165408835 19:35646034-35646056 CAGGAGGATGCCTTGAGGCCAGG + Intergenic
1165496324 19:36154019-36154041 CAGGTGGATCACTTGAGGCTGGG + Intergenic
1165960863 19:39533184-39533206 CAGGAGGATGGCTTGAGGCTGGG - Intergenic
1166038443 19:40187140-40187162 CAGGTGGATTCCTTGAGGCCAGG + Intergenic
1166198810 19:41223065-41223087 CAGGTGGATCACTTGAGGCTGGG + Intronic
1166950212 19:46422232-46422254 CAGGTGGATCACTTGAGGCTAGG - Intergenic
1167314788 19:48756934-48756956 CAGCTGAAAGCCTTGAAGCCGGG + Exonic
1167341331 19:48918305-48918327 CAGCTGCAGGGCTTCAGGCTCGG - Intronic
1167618970 19:50551002-50551024 CAGCGGCAGGCCTGGAGGCCGGG - Exonic
1167920791 19:52781621-52781643 CAGATGCATGCCATGATGCCTGG - Intronic
924981635 2:228103-228125 CAGCTTCATCCTTTGTGGCTAGG - Intronic
925201066 2:1968106-1968128 CAGCTGCGGGCCCTGGGGCTGGG - Intronic
925564959 2:5241393-5241415 CAGTTGGATCACTTGAGGCTAGG - Intergenic
925950397 2:8904199-8904221 CAGCTGGATCACTTGAGGCCAGG - Intronic
926017958 2:9470984-9471006 CAGGTGGATCACTTGAGGCTAGG + Intronic
926323349 2:11764372-11764394 CAGGTGCATGGCTTGAGCCCAGG - Intronic
926342834 2:11918661-11918683 CAGGTGGATGACTTGAGGCGAGG - Intergenic
926621285 2:15049158-15049180 CAGCTGCCGGCCTTGAGTCCTGG - Intergenic
926932207 2:18051857-18051879 CAGGTGCATGCCATTAGGCCCGG + Intronic
927138000 2:20111448-20111470 CATCAGCCTGCCTCGAGGCTGGG - Intergenic
928027214 2:27750300-27750322 CAGGTGGATCACTTGAGGCTAGG - Intergenic
928159678 2:28910923-28910945 CAGGTGCATCACTTGAGGCCAGG - Intronic
928639747 2:33285589-33285611 CAGCTGCATGCCATTATGCCCGG + Intronic
929101670 2:38320915-38320937 CAGGTGGATCACTTGAGGCTAGG + Intronic
929499007 2:42473922-42473944 CAGCTGGATCACTTGAGGCCAGG + Intronic
929719728 2:44355318-44355340 CAGGTGGATTGCTTGAGGCTGGG + Intronic
930184164 2:48395111-48395133 CAGCTGGATCACTTGAGGCCAGG - Intergenic
930829164 2:55724894-55724916 CAGCTGGATCACTTGAGTCTAGG + Intergenic
930967189 2:57343672-57343694 CAGGTGCATGCCTTTATGCCAGG - Intergenic
931066011 2:58588032-58588054 CAGGTGGATCCCTTGAGGCCAGG + Intergenic
931363362 2:61597507-61597529 CAGGTGGATGACTTGAGGCCAGG + Intergenic
933727898 2:85436825-85436847 CACCTGCATTCCTGGAGGCCAGG - Exonic
933745677 2:85569406-85569428 CAGGAGGATGCCTTGAGGCCAGG - Intronic
933901280 2:86852059-86852081 GAGGTGGATGCCTTGAGCCTGGG - Intronic
934700111 2:96432538-96432560 CAGGTGAATCCCTTGAGTCTAGG + Intergenic
934736504 2:96692313-96692335 CAGCTGCAAGCCTTGTCCCTGGG + Intergenic
934788969 2:97040880-97040902 CAGGTGCATCACTTGAGGCCAGG - Intergenic
934817505 2:97341680-97341702 CAGGTGCATCACTTGAGGCCAGG + Intergenic
934820191 2:97366804-97366826 CAGGTGCATCACTTGAGGCCAGG - Intergenic
935039251 2:99410236-99410258 CAGCTGGATCACTTGAGGCCAGG - Intronic
935385623 2:102497158-102497180 CAGATGCATCACTTGAGGCCAGG - Intronic
935779269 2:106497178-106497200 GAGGTGGATGCCTTGAGCCTGGG + Intergenic
936347789 2:111688285-111688307 CTGCTGCAGACTTTGAGGCTGGG + Intergenic
936551524 2:113446517-113446539 CAGGTGGATCCCTTGAGGCCAGG + Intronic
936754781 2:115694822-115694844 CAGCTGCCTGCCATGGGGCTGGG - Intronic
937131471 2:119517385-119517407 CAGGTGGATGGCTTGAGCCTGGG - Intronic
937386106 2:121434760-121434782 CAGGTGGATTACTTGAGGCTAGG + Intronic
937544808 2:123004170-123004192 CAGCTGCCTACCATGGGGCTGGG - Intergenic
937885861 2:126899661-126899683 AATCTGCATGCCTTGGGTCTTGG - Intronic
938181326 2:129187761-129187783 CAGGTGGATCACTTGAGGCTAGG + Intergenic
938317326 2:130339222-130339244 CAGCTGCAGGCCTGGAGGAAAGG + Exonic
938476535 2:131619979-131620001 CAGGTGCATGCCATGACGCCCGG + Intergenic
938652745 2:133400629-133400651 CAGCTGCCTGCAATGAGGCTGGG - Intronic
939202573 2:139056859-139056881 CAGTTGGATGCCTTGAGGTCAGG - Intergenic
939575368 2:143888640-143888662 CAGGTGGATTCCTTGAGCCTAGG - Intergenic
939954459 2:148514860-148514882 CAGTTGCATTCCATCAGGCTTGG - Intronic
941368116 2:164631745-164631767 CAGGTGGATGGCTTGAGCCTAGG + Intergenic
941573488 2:167200896-167200918 CAGCTGTATTACTTGAGGCCAGG + Intronic
941692001 2:168509831-168509853 CAGGAGGATGACTTGAGGCTAGG + Intronic
942239332 2:173944887-173944909 CAGCTGGATCACTTGAAGCTAGG + Intronic
942548801 2:177092740-177092762 CAGAAGAATGCCTTGAGGCCAGG - Intergenic
942632296 2:177963850-177963872 CAGCTGCACCCCTTCAGACTGGG + Intronic
943280612 2:185927938-185927960 CAGCTACATAATTTGAGGCTGGG - Intergenic
943638740 2:190335736-190335758 CAGGTGGATCCCTTGAGGTTAGG - Intronic
943700696 2:190985951-190985973 CTGTTTCATGCCCTGAGGCTCGG + Intronic
943878260 2:193102253-193102275 CAGGTGCTGGCCTAGAGGCTAGG + Intergenic
944102218 2:196039568-196039590 CAGCTGGATCACTTGAGGCCAGG + Intronic
944794738 2:203171375-203171397 CAGGAGCATCACTTGAGGCTAGG + Intronic
945036283 2:205706721-205706743 CAGCAGCCTGCCCTGAGGCTTGG - Intronic
945247086 2:207728501-207728523 CAGGTGGATGGCTTGAGGCCAGG - Intronic
945786674 2:214247933-214247955 CAGCAGGATGGCTTGAGTCTAGG + Intronic
946198593 2:218056150-218056172 TAGTTGGTTGCCTTGAGGCTTGG + Intronic
946722030 2:222619161-222619183 CAGGTGCATGCCACGATGCTTGG - Intronic
947147716 2:227083679-227083701 CAGCAGGATCCCTTAAGGCTAGG - Intronic
947339758 2:229125817-229125839 CAGCTGCCTGCATGAAGGCTAGG - Intronic
947699935 2:232224609-232224631 CAGGTGGATCCCTTGAGGTTAGG + Intronic
947861942 2:233366699-233366721 CTGCTGCATGACTGGGGGCTGGG - Intronic
947867785 2:233413168-233413190 CAGGTGGATCACTTGAGGCTAGG + Intronic
948112729 2:235469830-235469852 CAGGTGGATCACTTGAGGCTGGG + Intergenic
948317006 2:237035619-237035641 CAGGTGGATCACTTGAGGCTAGG + Intergenic
948575096 2:238944630-238944652 CAGAAGAATGGCTTGAGGCTCGG + Intergenic
1169700353 20:8439257-8439279 CTGCTAGATGCCTGGAGGCTTGG - Intronic
1170429628 20:16264241-16264263 CAGCTGCCTCCCTTAGGGCTGGG - Intergenic
1170551508 20:17481151-17481173 CAGCTGGATCACTTGAGGCCAGG + Intronic
1170623562 20:18013725-18013747 CAGGTGGATGGCTTGAGGCCAGG - Intronic
1170675353 20:18474659-18474681 CAGGTGCATGCCATCAGGCCCGG + Intronic
1170734744 20:19005141-19005163 CAGCTGAATGCCTTGCTGCGGGG + Intergenic
1170869383 20:20190889-20190911 CAGGTGGATTCCTTGAGGCCAGG + Intronic
1171229644 20:23473579-23473601 CAGCTGGATCACTTGAGGCCAGG + Intergenic
1172056888 20:32160264-32160286 CAGCTGAATACATGGAGGCTGGG - Intronic
1172584366 20:36072135-36072157 CAGGTGGATGACTTGAGGCCAGG + Intergenic
1173780709 20:45754605-45754627 CAGGTGGATGACTTGAGGCGAGG + Intronic
1173850995 20:46218149-46218171 CAGGTGGATCACTTGAGGCTAGG - Intronic
1174214861 20:48908588-48908610 CAGCTGGATCCCTTGAGCCCAGG + Intergenic
1174224616 20:48986930-48986952 CAGGAGGATCCCTTGAGGCTAGG - Intronic
1174320372 20:49737099-49737121 CAGGTGAATCACTTGAGGCTAGG - Intergenic
1174561844 20:51436479-51436501 CAGATGGATCACTTGAGGCTAGG + Intronic
1174624820 20:51905403-51905425 CAGCAGAATCACTTGAGGCTAGG - Intergenic
1174651618 20:52130439-52130461 CAGGAGCATCGCTTGAGGCTAGG - Intronic
1174832335 20:53824245-53824267 CAGGAGGATGGCTTGAGGCTAGG + Intergenic
1175645000 20:60663640-60663662 CACCTGCATCCCTGGAGCCTGGG - Intergenic
1176100448 20:63362084-63362106 CAGCTGCAGAGCCTGAGGCTGGG - Intronic
1176113955 20:63422997-63423019 CTGCTGCTGGCCCTGAGGCTGGG - Intronic
1177398072 21:20563333-20563355 CAGCAGCATTCCAAGAGGCTTGG + Intergenic
1177638673 21:23818459-23818481 CAGATGGATGACTTGAGGCCAGG + Intergenic
1177807272 21:25886620-25886642 CAGGTGGATCACTTGAGGCTAGG - Intronic
1178901504 21:36602643-36602665 CAGCTGCCTTCCTTGGGGCACGG - Intergenic
1179053440 21:37909595-37909617 CAGGTGGATCCCTTGAGGCCAGG - Intronic
1179145853 21:38766687-38766709 CAGGTGGATGGCTTGAGGCCAGG + Intergenic
1179211433 21:39327809-39327831 CAGGAGGATGACTTGAGGCTAGG + Intergenic
1179237336 21:39559525-39559547 CAGCTGCATGCCTGGGGGTCTGG + Intronic
1179270069 21:39844008-39844030 CAGGTGGATTGCTTGAGGCTAGG + Intergenic
1179789212 21:43746644-43746666 CAGGTGGATCACTTGAGGCTAGG - Intronic
1179818375 21:43922436-43922458 TCGCTGCCTGCCTTGAGGGTGGG - Intronic
1179818391 21:43922492-43922514 GTGCTGCCTGCCTTGAGGGTGGG - Intronic
1180075316 21:45458900-45458922 CAGCTGCATGGCTTGGGGGCTGG + Intronic
1180994271 22:19957317-19957339 CAGGAGGATGCCTTGAGCCTGGG + Intronic
1181113227 22:20614128-20614150 CAGGTGGATGGCTTGAGGCCGGG + Intergenic
1181644061 22:24220955-24220977 CAGGAGGATCCCTTGAGGCTAGG + Intronic
1182855236 22:33511251-33511273 CTGCTGTATGCCTTGAGGTGGGG + Intronic
1182900119 22:33890926-33890948 CTGTTGCATGCCTTGGCGCTAGG - Intronic
1182938102 22:34245863-34245885 TTGCTGCATGCCCTGAGGGTTGG - Intergenic
1184159048 22:42687189-42687211 CAGGTGGATCCCTTGAGGCCAGG + Intergenic
1184226952 22:43134565-43134587 CAGGTGGATGACTTGAGGCCAGG - Intronic
1184402515 22:44282177-44282199 GAGCCGAAGGCCTTGAGGCTGGG + Intronic
1184558325 22:45246060-45246082 CAGGTGTATCACTTGAGGCTAGG - Intergenic
1184682168 22:46078384-46078406 GAGCTGCAGGCGGTGAGGCTGGG - Intronic
949862242 3:8516254-8516276 CAGCTGCATCTCAGGAGGCTTGG + Intronic
950191478 3:10979701-10979723 CAGGTGGATCCCTTGAGGCCAGG - Intergenic
950248316 3:11442028-11442050 CAGGTGAATGGCTTGAGGCCAGG - Intronic
950377923 3:12587056-12587078 CAGGTGGATCACTTGAGGCTAGG - Intronic
950439117 3:12998120-12998142 CAGGTGGATCACTTGAGGCTAGG + Intronic
951049992 3:18083626-18083648 CAACTACCTGCCTTGGGGCTGGG - Intronic
951473780 3:23083049-23083071 CAGGTGGATTACTTGAGGCTAGG + Intergenic
951665601 3:25119994-25120016 AAACTGCATGCCTTGGAGCTGGG - Intergenic
952148582 3:30561366-30561388 CAGCTGCATGCCATTATGCCTGG - Intergenic
952698823 3:36303550-36303572 CAGCTACATTCCTTGTGGCTTGG - Intergenic
953186591 3:40643390-40643412 GAGCTGGATGCTCTGAGGCTGGG + Intergenic
953736066 3:45494923-45494945 CAGGTGCATGCCATGATGCCCGG - Intronic
954053499 3:48002651-48002673 CAGCTGGATCACTTGAGGCCAGG + Intronic
954942497 3:54387422-54387444 CAGGTGCATCGCTTGAGGCCAGG + Intronic
955614808 3:60795740-60795762 CAGCTGGATGGCTTGAGCCCAGG - Intronic
955928379 3:64030570-64030592 CAGGTGGATTGCTTGAGGCTGGG - Intergenic
956768048 3:72501221-72501243 CAGGTGGATAACTTGAGGCTGGG + Intergenic
956915663 3:73868330-73868352 CAGGTGGATGACTTGAGGCCAGG - Intergenic
957049672 3:75401729-75401751 CAGCTGAATGACTTGAATCTGGG + Intergenic
958416604 3:93881700-93881722 CAGGTGCATGCCATCAGGCTTGG + Intronic
958689672 3:97447797-97447819 CAGAGGCAGGGCTTGAGGCTTGG - Intronic
958892640 3:99797497-99797519 CAGGTGCATCACTTGAGGCCAGG - Exonic
959580200 3:107975672-107975694 CATCTGCAGGCCCTGAGGCATGG - Intergenic
959841210 3:110978431-110978453 CAGCAGAATCCCTTGAAGCTAGG + Intergenic
961033175 3:123624091-123624113 CAGCAGCATCGCTTGAGGCCAGG + Intronic
961239551 3:125398576-125398598 CAGGAGGATGCCTTGAGCCTAGG - Intergenic
961269296 3:125676744-125676766 CAGGTGAATGACTTGAGGCCAGG - Intergenic
961321119 3:126077148-126077170 CAGGTGGATCACTTGAGGCTAGG + Intronic
961348958 3:126287061-126287083 CAGGAGCATCCCTTGAGCCTAGG - Intergenic
961575414 3:127831991-127832013 CAGCAGCCTGCACTGAGGCTGGG + Intergenic
961881990 3:130068172-130068194 CAGCTGAATGACTTGAATCTGGG + Intergenic
961953542 3:130775503-130775525 CAGGTGGATCACTTGAGGCTAGG + Intergenic
962185429 3:133254108-133254130 CAGATGGATCCCTTGAGGCCAGG + Intronic
962455660 3:135563333-135563355 CAGGTGCATGCCAGGATGCTGGG + Intergenic
964515113 3:157499432-157499454 CAGCTGCATGGTTTGAGACTGGG + Intronic
964751761 3:160060200-160060222 CAGAGGGATGCCTTGAGGCCAGG + Intergenic
965257735 3:166437742-166437764 CTGCTGTTTCCCTTGAGGCTAGG - Intergenic
966024421 3:175258683-175258705 CAGCTGCATGCCTGGTGACTGGG + Intronic
966119693 3:176507992-176508014 AAGCTGCACACCTTCAGGCTGGG - Intergenic
966373864 3:179275771-179275793 CAGATGCATCCCTTGAGGCCAGG + Intergenic
966476780 3:180357971-180357993 CAGGTGGATCACTTGAGGCTGGG + Intergenic
968110509 3:196042623-196042645 CAGCTGCCTGCTGTGGGGCTGGG + Intronic
968341741 3:197961069-197961091 CAGCAGGCTGCCTTGAGGTTAGG - Intronic
969047010 4:4343730-4343752 CAGGTGCATCACTTGAGGCCAGG - Intergenic
970010595 4:11454730-11454752 CAGGTGCATGCCTTTATGCCTGG - Intergenic
970827515 4:20294118-20294140 CAGGTGGATCACTTGAGGCTAGG + Intronic
971210135 4:24608266-24608288 CAGCTGCTTGCCCTGAAGCATGG - Intergenic
971296084 4:25393432-25393454 CAGGTGGATCACTTGAGGCTTGG + Intronic
973123859 4:46558910-46558932 CAGGTGGATGACTTGAGGCCAGG - Intergenic
973232934 4:47863452-47863474 CAGGTGGATCACTTGAGGCTGGG + Intronic
973318178 4:48782656-48782678 CAGGTGGATGACTTGAGGCCAGG + Intergenic
973934430 4:55828602-55828624 CAGGAGCATGGCTTGAGGCCAGG + Intergenic
974282920 4:59822787-59822809 CAGGTGCATGCCTCCAGGCCTGG - Intergenic
974503283 4:62733107-62733129 CAGGTGCATGCCATCATGCTCGG + Intergenic
974527592 4:63063089-63063111 CAGGTGGATCACTTGAGGCTGGG - Intergenic
974902976 4:68023585-68023607 GAGCTACATCCCTTGAGCCTGGG + Intergenic
975473022 4:74792764-74792786 CGAATGCGTGCCTTGAGGCTTGG - Intronic
975682150 4:76887329-76887351 CAGCAGCAGGCCTTGAAGCTGGG - Intergenic
975787198 4:77904324-77904346 CAGGTGAATCACTTGAGGCTGGG + Intronic
976605804 4:86981594-86981616 CAGGTGGATCCCTTGAGGCCAGG - Intronic
976905950 4:90236083-90236105 CAGATGCATGCCACGATGCTTGG + Intronic
977261961 4:94807913-94807935 CAGGTGGATCACTTGAGGCTAGG - Intronic
977579608 4:98710729-98710751 CAGCTGCCTGCCATGGGGCTAGG + Intergenic
977596109 4:98883056-98883078 CAGGTGGATGACTTGAGGCTAGG + Intronic
979436818 4:120703017-120703039 CAACAGCATGAATTGAGGCTGGG - Intronic
979654361 4:123174972-123174994 CAGCTGCATGCCACCATGCTTGG + Intronic
981027298 4:140089848-140089870 CAGCAGGATGGCTTGAGGCCAGG - Intronic
982403442 4:154994520-154994542 CAGCTACATACCTTCTGGCTGGG - Intergenic
982667298 4:158281055-158281077 CAGCTGTATGGGATGAGGCTGGG + Intergenic
983674481 4:170276821-170276843 CAGGTGCATCACTTGAGGCCAGG + Intergenic
984156538 4:176201804-176201826 CAGGAGGATGGCTTGAGGCTAGG - Intergenic
985121342 4:186645716-186645738 CAGGTGAATCACTTGAGGCTAGG + Intronic
985485321 5:145451-145473 CAGTAGCATGGCTTGAGCCTGGG - Intronic
986629932 5:9761963-9761985 GAGCTGACTGCCTTTAGGCTGGG + Intergenic
988584645 5:32497907-32497929 CAGAAGGATTCCTTGAGGCTAGG + Intergenic
989074538 5:37550090-37550112 CAGATGGATGCCTTGAGGCGAGG - Intronic
989583054 5:43051453-43051475 CAGGTGGATCACTTGAGGCTAGG + Intergenic
990316744 5:54590016-54590038 CAGGAGGATGGCTTGAGGCTAGG - Intergenic
990462518 5:56042754-56042776 AAGCTGAATGTCTTGAGGCCAGG - Intergenic
990568017 5:57049602-57049624 CAGGTGGATTGCTTGAGGCTAGG + Intergenic
990935752 5:61147389-61147411 CAGCTGCATGCCACCAGGCCTGG + Intronic
991068960 5:62455950-62455972 CAGGTGGATCGCTTGAGGCTAGG - Intronic
991389448 5:66126578-66126600 CAGCAGGATTGCTTGAGGCTAGG + Intergenic
991586018 5:68202664-68202686 CAGGAGGATGGCTTGAGGCTAGG - Intergenic
991730720 5:69585093-69585115 CAGGTGGATCACTTGAGGCTAGG + Intronic
991807156 5:70440257-70440279 CAGGTGGATCACTTGAGGCTAGG + Intergenic
991864230 5:71042763-71042785 CAGGTGGATCACTTGAGGCTAGG - Intronic
992167583 5:74070046-74070068 CAGGAGCATGCCTTGAGGCCAGG - Intergenic
992306654 5:75447092-75447114 CAGCTGCCTGCCACGGGGCTGGG + Intronic
992492742 5:77260819-77260841 CAGGTGGATCACTTGAGGCTAGG - Intronic
992733339 5:79693766-79693788 CAGCTGTATTCCTTGTGCCTAGG - Intronic
992753576 5:79883436-79883458 CAGCTGCCTGCCACGAAGCTGGG + Intergenic
992826265 5:80553053-80553075 CAGGTGAATCCCTTGAGGCCAGG + Intergenic
993190871 5:84678849-84678871 CAGGTGCATGCCATCATGCTTGG + Intergenic
993339303 5:86703236-86703258 AAGCTGCAGGTCTTGAGACTTGG + Intergenic
993510366 5:88763877-88763899 CAGGAGCATCCCTTGAGTCTAGG - Intronic
993524410 5:88946465-88946487 CAGGTGGATCGCTTGAGGCTAGG - Intergenic
993648841 5:90493473-90493495 CAGCTGGATCCCTTGAGTCCAGG - Intronic
995111611 5:108435261-108435283 CAGCAGGATCCCTTGAGGCCAGG - Intergenic
996233992 5:121104951-121104973 CAGCTGGATCCTTTGAGTCTAGG + Intergenic
996730210 5:126709956-126709978 CAGGTGCATCACTTGAGGCCAGG - Intergenic
997287747 5:132694260-132694282 CAGCTGTATGCCATCATGCTCGG - Exonic
997332793 5:133078405-133078427 CAGGTGCATCACTTGAGGTTAGG + Intronic
997548270 5:134729606-134729628 CAGGTGGATCACTTGAGGCTAGG - Intergenic
998209257 5:140181858-140181880 CAGGAGGATCCCTTGAGGCTAGG - Intronic
998395891 5:141817590-141817612 CAGGTGGATCACTTGAGGCTAGG + Intergenic
998829064 5:146137978-146138000 CAGGTGCCTGCCATGATGCTCGG - Intronic
999001063 5:147923215-147923237 CAGCTCCATTTCTTGAGTCTGGG + Intergenic
999311934 5:150557261-150557283 AGGCTGCATGCCTGAAGGCTGGG + Exonic
1000007867 5:157204151-157204173 CAGGTGCACACCATGAGGCTTGG + Intronic
1000087656 5:157902136-157902158 CAGGAGCATGCCTTGAGCCCAGG + Intergenic
1000971767 5:167722656-167722678 CAGCTGCCTGCCTAGTAGCTGGG - Intronic
1001537585 5:172508981-172509003 TAGCTGCATGGCTTGGGCCTGGG + Intergenic
1001650146 5:173310246-173310268 CGGCTTCATGCCTTCATGCTGGG - Intergenic
1002003107 5:176209616-176209638 CAGGTGGATCACTTGAGGCTAGG - Intergenic
1002008998 5:176261517-176261539 CAGGTGGATCACTTGAGGCTGGG + Intronic
1002041180 5:176515473-176515495 CAGGAGCATGACTTGAGCCTGGG - Intergenic
1002281788 5:178134737-178134759 CAGGTGGATCACTTGAGGCTAGG + Intronic
1002561732 5:180087144-180087166 CAGGAGCATGGCTTGAGCCTGGG - Intergenic
1003109773 6:3243796-3243818 CAGGTGCATGCCATGATGCCTGG + Intronic
1003278322 6:4671264-4671286 CAGCTGGATCACTTGAGGCCAGG + Intergenic
1003701915 6:8475952-8475974 CAGGTAGATCCCTTGAGGCTAGG - Intergenic
1004647481 6:17576265-17576287 CAGGTGGATGGCTTGAGGCCAGG - Intergenic
1005523553 6:26623207-26623229 CAGGTGGATGGCTTGAGCCTAGG + Intergenic
1006635567 6:35459006-35459028 CAGCTGGATCACTTGAGGCCAGG - Intronic
1006745873 6:36341651-36341673 CAGTTGCATGCCATAAGGCCTGG - Intergenic
1008151764 6:47961519-47961541 CAGCTGAATCACTTGAGGCCAGG - Intronic
1008505504 6:52225961-52225983 CAGGTGGATCACTTGAGGCTGGG - Intergenic
1008616001 6:53226737-53226759 CAGGTGAATTGCTTGAGGCTGGG + Intergenic
1008935559 6:56988157-56988179 CAGGTGCATGCCATCAGGCCCGG + Intronic
1008992129 6:57615274-57615296 CAGGTGCATGCCTCGACGCCTGG - Intronic
1010517413 6:76790037-76790059 AAGGTGCATGCCATAAGGCTGGG - Intergenic
1011316956 6:86044521-86044543 CAGATGGATGACTTGAGCCTAGG - Intergenic
1012725230 6:102802271-102802293 CAGGAGGATCCCTTGAGGCTAGG - Intergenic
1013151698 6:107452457-107452479 CAGGTGGATCACTTGAGGCTAGG - Intronic
1013233630 6:108177395-108177417 CAGCTGTAGGCCTGGAGGGTAGG - Intronic
1013355351 6:109341481-109341503 CAGCTGCAGCCATGGAGGCTTGG - Intergenic
1014522946 6:122467375-122467397 CAGGTGGATCACTTGAGGCTAGG + Intronic
1014679998 6:124416494-124416516 CAGGTGCATGCCATCACGCTTGG - Intronic
1015552581 6:134427469-134427491 CAGGTGGATGACTTGAGGCCAGG + Intergenic
1015635879 6:135273605-135273627 CAGGTGGATTACTTGAGGCTAGG - Intergenic
1015947174 6:138514688-138514710 CAGGTGGATGGCTTGAGCCTAGG + Intronic
1016886734 6:148965994-148966016 CAGGTGCATCACTTGAGGCCAGG + Intronic
1017054979 6:150428569-150428591 CAGGTGCATGCCATGACGCCTGG + Intergenic
1017130479 6:151104309-151104331 CAGGTGGATGGCTTGAGGCCAGG - Intergenic
1017140259 6:151183697-151183719 CAGCAGAATCCCTTGAGCCTAGG - Intergenic
1017167142 6:151419290-151419312 CAGGTGGATTGCTTGAGGCTGGG - Intronic
1017239479 6:152150982-152151004 CAGCTGGATCACTTGAGGTTAGG + Intronic
1017468588 6:154717748-154717770 CAGGTGCATCACTTGAGGCCAGG - Intergenic
1017910258 6:158786229-158786251 CAGCTGCATGCCATCATGCCCGG - Intronic
1018663260 6:166108565-166108587 CAGGTGGATCACTTGAGGCTAGG - Intergenic
1019269663 7:139895-139917 CTGCTGCATGAGTTCAGGCTGGG + Intergenic
1019615663 7:1959022-1959044 CAGCTGGATCGCTTGAGGCCAGG + Intronic
1019872146 7:3774464-3774486 CAGCTGCCTGCCATGGGACTGGG + Intronic
1020083376 7:5297991-5298013 CAGCTGCCGGCCCTGAGCCTGGG - Intronic
1021021553 7:15604858-15604880 CAGGAGAATCCCTTGAGGCTAGG - Intergenic
1021533372 7:21674584-21674606 CAGATGGATCACTTGAGGCTAGG - Intronic
1022664498 7:32398168-32398190 CAGGTGCATGCCATCATGCTTGG - Intergenic
1022755301 7:33281601-33281623 CAGGAGAATGGCTTGAGGCTAGG - Intronic
1022984424 7:35636903-35636925 CAGATGGATCCCTTGAGGCCAGG + Intronic
1023702253 7:42904260-42904282 CAGACGAATGCCTGGAGGCTTGG + Intergenic
1023906223 7:44523487-44523509 CAGCTGCATGCCTTGAGGCTGGG - Intronic
1024233999 7:47384266-47384288 CAGCTGTGTGCCTAGAGGCCGGG + Intronic
1024571632 7:50727924-50727946 CACCTGCATGGCTTTAGGCATGG - Intronic
1024711883 7:52024835-52024857 CAGATGGATCACTTGAGGCTAGG + Intergenic
1025188209 7:56877242-56877264 CAGCTGGGAGCCTTGAGCCTGGG + Intergenic
1025235075 7:57228823-57228845 GAGCTGCATGGCTTTAGGCCAGG + Intergenic
1025683714 7:63699678-63699700 CAGCTGGGAGCCTTGAGCCTGGG - Intergenic
1026586211 7:71658132-71658154 CAGCAGGATTCCTTGAGGCCAGG - Intronic
1026659921 7:72291837-72291859 CAGGTGCATCACTTGAGGTTGGG - Intronic
1026682489 7:72477785-72477807 CAGGAGGATCCCTTGAGGCTAGG - Intergenic
1026776520 7:73234585-73234607 CAGAGGCAGCCCTTGAGGCTGGG - Intergenic
1026902593 7:74045282-74045304 CAGCTGCATACCTGGAGCCTTGG - Exonic
1026904852 7:74057008-74057030 CAGGTGGATCCCTTGAGGCCAGG + Intronic
1027017371 7:74787955-74787977 CAGAGGCAGCCCTTGAGGCTGGG - Intronic
1027070651 7:75157977-75157999 CAGAGGCAGCCCTTGAGGCTGGG + Intergenic
1027424797 7:78051810-78051832 CAGGTGGATGACTTGAGGCCAGG - Intronic
1027462524 7:78472901-78472923 CTGCTGCATGCCTAGTGGCGAGG + Intronic
1027500288 7:78941561-78941583 CAGGTGGATGGCTTGAGGCCAGG - Intronic
1028021898 7:85787084-85787106 CAGGTGGATCCCTTGAGGCCAGG + Intergenic
1028813751 7:95120182-95120204 CAGGTGGATGGCTTGAGGCCAGG - Intronic
1028841256 7:95432180-95432202 CAGGAGCATCACTTGAGGCTGGG + Intronic
1029088920 7:98032844-98032866 CAGGTGGATCCCTTGAGGCCAGG + Intergenic
1029185641 7:98736488-98736510 CAGGTGGATCACTTGAGGCTGGG + Intergenic
1029199253 7:98827583-98827605 CAGGAGGATCCCTTGAGGCTGGG + Intergenic
1029636190 7:101785819-101785841 CAGGAGCATGGCTTGAGGCCAGG + Intergenic
1030012358 7:105182693-105182715 CAGGTGGATTGCTTGAGGCTAGG - Intronic
1030027736 7:105341443-105341465 CAGCTGGATCGCTTGAGGCCAGG + Intronic
1030234557 7:107244017-107244039 CAGCTGGATCCCTTGAGGTTAGG + Intronic
1030307727 7:108036083-108036105 CAGGTGGATCACTTGAGGCTAGG - Intronic
1031100603 7:117475595-117475617 CAGGTGGATGGCTTGAGCCTGGG - Intronic
1031345676 7:120662895-120662917 CATCTGAATGCTTTCAGGCTAGG + Intronic
1032053667 7:128667026-128667048 CAGATGGATCACTTGAGGCTAGG - Intergenic
1032257078 7:130305970-130305992 CTGCAGCATGCCATGTGGCTGGG + Intronic
1032370555 7:131346293-131346315 CAGGTGGATCACTTGAGGCTAGG + Intronic
1033049555 7:137991677-137991699 CAGGTGGATCACTTGAGGCTAGG + Intronic
1033094335 7:138417035-138417057 CAGGTGGATCACTTGAGGCTGGG - Intergenic
1033354010 7:140584969-140584991 CAGCTGGATCACTTGAGCCTAGG + Intronic
1033650688 7:143340758-143340780 CAGGTGGATGACTTGAGGCCAGG - Intronic
1034288451 7:149907346-149907368 CTGCTGCGTGTCTTGGGGCTGGG - Intergenic
1034406741 7:150909042-150909064 CAGCTGGATCACTTGAGGCCAGG - Intergenic
1034662681 7:152785634-152785656 CTGCTGCGTGTCTTGGGGCTGGG + Intronic
1034718060 7:153262034-153262056 CAGCAGCATGACCTGCGGCTGGG + Intergenic
1035439644 7:158885567-158885589 CAGGTGGATGACTTGAGGCCAGG - Intronic
1036654691 8:10670649-10670671 CAGGGGGATGGCTTGAGGCTAGG + Intronic
1036779365 8:11634969-11634991 CAGCTGCAGGCATTGGGGCAGGG - Intergenic
1037026676 8:14047012-14047034 CAACTTCAGACCTTGAGGCTGGG + Intergenic
1037137294 8:15478191-15478213 CAGGTGTATGACTTGAGGCCCGG - Intronic
1038825090 8:30990895-30990917 CAGGTGGATCACTTGAGGCTGGG - Intergenic
1039021873 8:33216982-33217004 CAGGTGGATCACTTGAGGCTGGG + Intergenic
1039143266 8:34416966-34416988 CAGGAGGATGGCTTGAGGCTGGG - Intergenic
1039534125 8:38292827-38292849 CAGATGCATGCCATGATGCCTGG - Intronic
1039534148 8:38292993-38293015 CAGATGCATGCCATGACGCCTGG - Intronic
1039606998 8:38889357-38889379 CAGCTGGATCACTTGAGGCCAGG - Intergenic
1039744029 8:40407625-40407647 CAGGAGGATGGCTTGAGGCTAGG + Intergenic
1040901359 8:52419994-52420016 CAGATGGATGACTTGAGGCCAGG + Intronic
1040922446 8:52637428-52637450 CAGCAGGATCCCTTGAGCCTAGG - Intronic
1041123648 8:54612348-54612370 CAGCTGCCTGCCATGGGGCTGGG + Intergenic
1041211593 8:55557443-55557465 CAGGTGGATTACTTGAGGCTAGG - Intergenic
1042221558 8:66479272-66479294 CAGGAGGATGCCTTGAGGCCAGG + Intronic
1042872644 8:73412324-73412346 CAAGTGGATGGCTTGAGGCTAGG - Intergenic
1042874235 8:73426018-73426040 CAGGTGGATCACTTGAGGCTAGG - Intronic
1045163794 8:99580418-99580440 CAGATGGATCCCTTGAGGCCAGG - Intronic
1045580715 8:103476735-103476757 CAGGAGAATCCCTTGAGGCTAGG + Intergenic
1045869298 8:106907141-106907163 CAGATGGATCACTTGAGGCTAGG - Intergenic
1046559985 8:115824074-115824096 CAGCTGCAGACCTTGAGACGGGG + Intergenic
1046938511 8:119908359-119908381 CAGAAGCATGGCTTGAGGCCAGG + Intronic
1047728448 8:127705202-127705224 CAGGTGGATCACTTGAGGCTAGG - Intergenic
1048333920 8:133489439-133489461 CAGCTGGATGCCCTGAGCCCTGG + Intronic
1048919624 8:139216031-139216053 CAGCTGCATGCCCTGAAGCCAGG + Intergenic
1049278149 8:141730212-141730234 CAGCTGCAGCCCTTGAAGATGGG + Intergenic
1049901474 9:170611-170633 CAGGTGGATCCCTTGAGGCCAGG - Intronic
1050792345 9:9488815-9488837 CAGCTGCTTGCAGTGTGGCTAGG - Intronic
1051901522 9:22048020-22048042 CAGGTGGATACCTTGAGCCTAGG - Intergenic
1052874237 9:33541472-33541494 TAGAAGCATCCCTTGAGGCTTGG + Intronic
1053196931 9:36126806-36126828 CAGCCTAATGCCCTGAGGCTGGG - Intergenic
1053243521 9:36516209-36516231 CAGGTGGATCACTTGAGGCTGGG - Intergenic
1053501804 9:38602893-38602915 TAGAAGCATCCCTTGAGGCTTGG - Intergenic
1053744508 9:41180906-41180928 CAGGTGGATCCCTTGAGGCCAGG - Intronic
1054349776 9:64010796-64010818 CAGGTGGATCCCTTGAGGCCAGG - Intergenic
1054482762 9:65684307-65684329 CAGGTGGATCCCTTGAGGCCAGG + Intronic
1054683836 9:68250344-68250366 CAGGTGGATCCCTTGAGGCCAGG + Intronic
1054772172 9:69093293-69093315 CAGGTGGATCACTTGAGGCTAGG + Intronic
1054962671 9:70986130-70986152 CAGGAGGATCCCTTGAGGCTAGG + Intronic
1055033043 9:71789980-71790002 CAGGTGGATCACTTGAGGCTAGG - Intronic
1055493104 9:76826244-76826266 CAGGTGGATGACTTGAGGCCAGG + Intronic
1055529011 9:77164684-77164706 CAGATGGATGGCTTGAGGCCAGG - Intergenic
1055601423 9:77923082-77923104 CTGGTGCACCCCTTGAGGCTAGG - Intronic
1056164301 9:83926614-83926636 CAGCAGGATCACTTGAGGCTAGG - Intergenic
1056318906 9:85418359-85418381 CAGTTCCATGCCTGGAGGCCTGG + Intergenic
1057080335 9:92169752-92169774 CAGGTGCATGCCATGATGCCTGG - Intergenic
1057120266 9:92565496-92565518 CAGCTGCCTGCCCTGGGGCTGGG - Intronic
1057290300 9:93802077-93802099 CAGCTGAGGGCCTCGAGGCTCGG - Intergenic
1057340532 9:94197638-94197660 CAGATGCAGGCCTTGAGTCCTGG - Intergenic
1057681185 9:97187186-97187208 TAGAAGCATCCCTTGAGGCTTGG - Intergenic
1057948199 9:99348252-99348274 CAGGTGGATCACTTGAGGCTAGG - Intergenic
1057977115 9:99617646-99617668 CAGGTGTATTGCTTGAGGCTGGG - Intergenic
1058528919 9:105886789-105886811 CAGATGCATGCCATGATGCCCGG + Intergenic
1058721216 9:107766245-107766267 CAGATGGATGGCTTGAGCCTAGG + Intergenic
1058914337 9:109551157-109551179 CAGGTGGATCACTTGAGGCTAGG - Intergenic
1059110853 9:111557229-111557251 CAGGTGCATGCCATGATGCCCGG - Intronic
1059293306 9:113246865-113246887 CAGGTGAATCACTTGAGGCTAGG - Intronic
1059494111 9:114695404-114695426 CAGGAGGATGCCTTGAGCCTGGG - Intergenic
1059576885 9:115498914-115498936 CAGGTGGATCACTTGAGGCTAGG - Intergenic
1059603293 9:115805232-115805254 CAGGTGCATGCCATCAGGCCTGG - Intergenic
1061120214 9:128637294-128637316 CTGCTGCAGCCCCTGAGGCTTGG - Intronic
1061448127 9:130653260-130653282 CAGCAGGATCACTTGAGGCTAGG + Intergenic
1061979406 9:134092324-134092346 CAGGTGGATGCCTTGAGCCCAGG + Intergenic
1062100741 9:134727177-134727199 CAGCCCCATGCCTTGAAGCAGGG - Intronic
1062351311 9:136140674-136140696 CAGGTGGATGACTTGAGGCCAGG - Intergenic
1062573440 9:137195809-137195831 CACCTGCCTCCCTTGAGACTCGG - Intronic
1062699327 9:137890808-137890830 GAGCTGGAGGCCGTGAGGCTGGG + Intronic
1203785137 EBV:123427-123449 CAGCTGCATTCCAAGAGGCCCGG - Intergenic
1185635133 X:1546754-1546776 CAGCTGCAGACCCTCAGGCTGGG + Intergenic
1186117144 X:6316819-6316841 CAGGAGAATGCCTTGAGCCTGGG - Intergenic
1186178245 X:6947563-6947585 CAGGAGGATTCCTTGAGGCTAGG + Intergenic
1186488248 X:9950666-9950688 CAGGAGCATGGCTTGAGGCCAGG - Intergenic
1186587446 X:10890661-10890683 CAGCTGCATGCCACGATGCCTGG - Intergenic
1186738596 X:12493508-12493530 AAGCTGCATCCTTTGAGACTTGG - Intronic
1186889917 X:13949790-13949812 CAGGTGGATTGCTTGAGGCTGGG + Intergenic
1187314481 X:18179947-18179969 CAGATGGATCACTTGAGGCTAGG + Intronic
1187465936 X:19527707-19527729 CAGGTGGATCACTTGAGGCTAGG - Intergenic
1188614506 X:32141196-32141218 CGGGTGGATGACTTGAGGCTAGG + Intronic
1188771896 X:34163127-34163149 CAGGTGCTAGCCTAGAGGCTAGG + Intergenic
1188795998 X:34465969-34465991 CAGGTGTATGCCATGATGCTTGG - Intergenic
1188797533 X:34484194-34484216 CAGGTGCTAGCCTAGAGGCTAGG + Intergenic
1189275436 X:39781883-39781905 CAGATGGATCCCTTGAGGCCAGG - Intergenic
1189463347 X:41259916-41259938 GAGGTGCAGGCCTTGAGCCTGGG - Intergenic
1190110305 X:47585219-47585241 CAGCGGCATCCCCTAAGGCTTGG - Exonic
1190147832 X:47913283-47913305 CAGGAGGATGGCTTGAGGCTAGG + Intronic
1190369862 X:49730342-49730364 CAGGTGCATCACTTGAGGCCAGG - Intergenic
1190702296 X:52998025-52998047 CAGGTGGATCACTTGAGGCTAGG - Intergenic
1190993486 X:55579082-55579104 AAGTTGCATGCCATGAGGTTTGG - Intergenic
1191007029 X:55720611-55720633 CAGGTGCATCACTTGAGGCCAGG + Intronic
1192038344 X:67589817-67589839 CAGCTCCTCCCCTTGAGGCTTGG - Intronic
1192094845 X:68199831-68199853 CAGGTGGATGTCTTGAGGCCAGG + Intronic
1192786419 X:74340444-74340466 CACCTGCATGCCACGTGGCTGGG + Intergenic
1194311576 X:92315676-92315698 CAGGTGTATGCCATGATGCTGGG + Intronic
1195135858 X:101906741-101906763 CAGAAGCAAGCCTGGAGGCTGGG - Intronic
1195516004 X:105776777-105776799 CAGGTGCATGCCTTCATGCCAGG + Intergenic
1195802059 X:108723649-108723671 CAGGTGGATCCCTTGAGGCCAGG + Intronic
1197242275 X:124132876-124132898 CAGCTGGATCACTTGAGGCCAGG - Intronic
1197768829 X:130076295-130076317 CAGGTGCATCGCTTGAGCCTAGG + Intronic
1197935763 X:131738742-131738764 CAGGTGCATAGCTTGAGCCTAGG + Intergenic
1198207237 X:134478518-134478540 CAGGAGCATCCCTTGAGCCTAGG + Intronic
1198967760 X:142245058-142245080 CAGGGGCAGGCCTGGAGGCTGGG - Intergenic
1199651940 X:149953823-149953845 CAGGTGCATCACTTGAGGCCAGG - Intergenic
1199976044 X:152895477-152895499 CTGCTGCCTGCCTCCAGGCTGGG - Intergenic
1200619851 Y:5429810-5429832 CAGGTGTATGCCATGATGCTGGG + Intronic
1201374531 Y:13302621-13302643 CAGATGGATGTCTTGAGCCTAGG - Intronic
1201797124 Y:17908125-17908147 CAGCTTAATCCCTTGAAGCTGGG - Intergenic
1201804429 Y:17997860-17997882 CAGCTTAATCCCTTGAAGCTGGG + Intergenic