ID: 1023906225

View in Genome Browser
Species Human (GRCh38)
Location 7:44523492-44523514
Sequence ATACACAGCTGCATGCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023906225_1023906229 22 Left 1023906225 7:44523492-44523514 CCTCAAGGCATGCAGCTGTGTAT 0: 1
1: 0
2: 3
3: 20
4: 151
Right 1023906229 7:44523537-44523559 ACAGCTTGCAGGAGCCAGGTAGG 0: 1
1: 2
2: 20
3: 48
4: 341
1023906225_1023906230 27 Left 1023906225 7:44523492-44523514 CCTCAAGGCATGCAGCTGTGTAT 0: 1
1: 0
2: 3
3: 20
4: 151
Right 1023906230 7:44523542-44523564 TTGCAGGAGCCAGGTAGGCAAGG No data
1023906225_1023906227 11 Left 1023906225 7:44523492-44523514 CCTCAAGGCATGCAGCTGTGTAT 0: 1
1: 0
2: 3
3: 20
4: 151
Right 1023906227 7:44523526-44523548 GCAGCTTGTACACAGCTTGCAGG No data
1023906225_1023906228 18 Left 1023906225 7:44523492-44523514 CCTCAAGGCATGCAGCTGTGTAT 0: 1
1: 0
2: 3
3: 20
4: 151
Right 1023906228 7:44523533-44523555 GTACACAGCTTGCAGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023906225 Original CRISPR ATACACAGCTGCATGCCTTG AGG (reversed) Intronic
900733673 1:4280879-4280901 ACATACAGCTCCATGCCCTGAGG + Intergenic
902719578 1:18295162-18295184 ATACACACCTGCACCCCCTGGGG - Intronic
903354713 1:22739638-22739660 TTACACAGATGAATTCCTTGAGG - Intronic
905310002 1:37042623-37042645 CTCCACAGCTGCATTCCTTCTGG - Intergenic
905330304 1:37190475-37190497 AGACACAGAAGCATTCCTTGGGG - Intergenic
906031131 1:42720962-42720984 ATGCACAGCTTCCTGCCATGGGG - Intergenic
907513471 1:54979283-54979305 ACACACAGATGCCTGCCCTGTGG + Intergenic
911925799 1:103830822-103830844 ATACACAACTGCCTGCCAAGGGG + Intergenic
911927507 1:103853250-103853272 ATGCACAGCAGCATGGGTTGAGG - Intergenic
912011806 1:104975682-104975704 ATACACAGCTTCTTGCATTTTGG - Intergenic
912418391 1:109527268-109527290 GGACACAGATGCATGCATTGTGG - Intergenic
912637014 1:111305510-111305532 ATGCACAGCTGCCTGCCTTGGGG + Intronic
912932116 1:113973292-113973314 ATAGGCTGCAGCATGCCTTGAGG - Exonic
915102306 1:153509210-153509232 ACACCCAGCTCCATGCCTGGAGG - Intergenic
916444559 1:164860210-164860232 TTATACACCTGCATGACTTGGGG - Intronic
919384001 1:196896603-196896625 ACATACAGCTGCCTGCCATGTGG + Intronic
921862214 1:220051750-220051772 ACACACAGCTTCATGACTTCAGG - Intergenic
922671500 1:227511427-227511449 GTACACAGCTGCATGCAAAGGGG - Intergenic
922951788 1:229563952-229563974 TTACACAGCTGCAAGCCAAGGGG + Intergenic
924418421 1:243883587-243883609 ATACACAGTTCCTTGCCATGTGG - Intergenic
1063481671 10:6381831-6381853 ATACATAGCTGCCTTCATTGTGG + Intergenic
1064258492 10:13765854-13765876 ATTCCCACCTGAATGCCTTGGGG + Intronic
1064850616 10:19705285-19705307 AAAAGCAGCTGTATGCCTTGAGG - Intronic
1065407192 10:25382277-25382299 ACACACAGCAAGATGCCTTGTGG - Intronic
1065981846 10:30905312-30905334 AAACACTGCTTCATGCCTCGTGG - Intronic
1066420287 10:35258958-35258980 ATGCACTGCTGCCTGCCGTGGGG + Intronic
1068008685 10:51420956-51420978 ATAGACAGCATCAAGCCTTGAGG + Intronic
1072495716 10:95957108-95957130 GTACACAGCTGCCTGCCATGGGG - Intronic
1072814854 10:98496530-98496552 ATACACAGCTACCTGCCATAGGG + Intronic
1079137067 11:17781416-17781438 TCACACACCTGCATGCCTTCTGG - Intronic
1079826234 11:25198816-25198838 ATACACAACTGTATGACTTTGGG - Intergenic
1080547604 11:33336333-33336355 ATACACAGCTGTGTCTCTTGGGG - Intronic
1082979742 11:59108345-59108367 GTACACAGCTGAATGCTTTAGGG + Intronic
1084299289 11:68235879-68235901 ATGCACAGCTGCGTGCCATAGGG + Intergenic
1084897300 11:72282733-72282755 GTGCACAGCTGCCTGCCATGGGG + Intergenic
1085321444 11:75576511-75576533 ATGCACAGCAGCATCCCTTCAGG + Intergenic
1087369693 11:97267370-97267392 ATGGACAGCTGCATGCTTAGTGG - Intergenic
1087728912 11:101756495-101756517 GAGCACAGATGCATGCCTTGGGG + Intronic
1090544305 11:127746391-127746413 ATAGACAGCTTCAAGCCTTGAGG + Intergenic
1092011421 12:5116016-5116038 AGAGGCAGCTGCCTGCCTTGTGG - Intergenic
1093829904 12:23743197-23743219 ATAGACATGTGCATGCATTGAGG - Intronic
1096381247 12:51159862-51159884 GTGCACAGCTGCCTGCCATGGGG + Intronic
1098975596 12:76898963-76898985 ACACACAGCTGCCTTCCTTCAGG + Intergenic
1101273729 12:103176346-103176368 AGACTCAGCTGCCTGCCTTAAGG - Intergenic
1107157379 13:37184955-37184977 ATACACAGCTGTGTGTCATGGGG - Intergenic
1107319041 13:39166357-39166379 GTTCACAGCTGCATCCCTTTTGG + Intergenic
1107869559 13:44734572-44734594 AACCACAGCTGCCTGGCTTGGGG + Intergenic
1109570476 13:64182291-64182313 ATACACTGCTGCTTTCTTTGAGG - Intergenic
1110352683 13:74528075-74528097 ATTCTCAGCTCTATGCCTTGAGG + Intergenic
1113485540 13:110649903-110649925 ATCCAGAGCTGCATCCCTGGTGG - Intronic
1113523775 13:110958149-110958171 TGACACAGGTGCATGCATTGCGG - Intergenic
1116264410 14:42668278-42668300 ATGCACAGCTGTCTGCCCTGGGG - Intergenic
1118155420 14:63236267-63236289 ATACCCAGCTGAATGCCTTCTGG + Intronic
1120413776 14:84193792-84193814 ATACACGGCACCATGTCTTGAGG - Intergenic
1122460436 14:101890054-101890076 ATTTACAGCTGCAGGCCTTGAGG + Intronic
1123207143 14:106724562-106724584 GCACACAGCTGCATTCCTAGAGG + Intergenic
1123212168 14:106771565-106771587 GCACACAGCTGCATTCCTAGAGG + Intergenic
1124095457 15:26644684-26644706 ATACACTGCTGCAGCCCATGAGG + Intronic
1125066316 15:35489651-35489673 ATACACTGTTGTATGCCTTAGGG - Intronic
1125835781 15:42749468-42749490 GTGCACAGCTGCCTGCCATGGGG - Intronic
1128625191 15:69194173-69194195 AAATACAGCTGCATGCCCAGTGG - Intronic
1129034620 15:72641795-72641817 AAACAAAGCTTCATTCCTTGTGG + Intergenic
1129215262 15:74095421-74095443 AAACAAAGCTTCATTCCTTGTGG - Intergenic
1129358459 15:75009249-75009271 ATACACAGGTGCATTAATTGCGG - Intronic
1132223205 15:100120334-100120356 AGACATAGCTGCCTGCCTTGTGG - Intronic
1132275456 15:100559400-100559422 AAACACAGCAGCATGCCATTTGG - Intronic
1133462894 16:6002437-6002459 ATGCAAAGGTGCATGCCATGTGG - Intergenic
1135720933 16:24817590-24817612 AAACACATCTAAATGCCTTGAGG - Intronic
1136188064 16:28599706-28599728 TTACACAGCTCCATCCCGTGAGG + Intergenic
1136190536 16:28612700-28612722 TTACACAGCTCCATCCCGTGAGG + Intronic
1136316473 16:29457523-29457545 TTACACAGCTCCATCCCATGAGG - Intronic
1136431050 16:30196865-30196887 TTACACAGCTCCATCCCATGAGG - Intronic
1138629114 16:58279521-58279543 CTACACAGCAGCATGCATGGAGG + Intronic
1140774652 16:78238980-78239002 ATGCAAATCTGCAGGCCTTGGGG - Intronic
1143781468 17:9231727-9231749 ATATACATCTGCAGGCCTGGTGG + Intronic
1144368296 17:14566592-14566614 ATTCAAAGCTTCCTGCCTTGAGG - Intergenic
1146404468 17:32525355-32525377 TCCCACAGCTGCATGCCATGTGG - Intronic
1146489413 17:33269536-33269558 ATACACAGCTGGCTTCCTGGGGG - Intronic
1146949413 17:36895283-36895305 ATAGACAGCTTCATGCCCTAAGG + Intergenic
1147314427 17:39612771-39612793 ATATGCGGCTGCGTGCCTTGTGG + Intergenic
1149368147 17:55966114-55966136 CTACACAGCAGCAAGACTTGGGG - Intergenic
1149421093 17:56511249-56511271 ATACTCAGCAGCATGCTTTAGGG + Intronic
1149774707 17:59348225-59348247 CAACACAGAGGCATGCCTTGGGG + Intronic
1151670217 17:75568183-75568205 AGGCACAGCTGCATGCCTCTGGG + Intronic
1153864869 18:9256932-9256954 ATACTCAACTGGAGGCCTTGGGG - Exonic
1154204821 18:12327487-12327509 AAACACAGCAGCATGGCTTGAGG + Intronic
1154400099 18:14028624-14028646 ATGCACAGCTGCCTGCCATGGGG - Intergenic
1162966838 19:14160151-14160173 ATGCCCAGCTGCAGGCCCTGCGG - Exonic
1165080989 19:33305854-33305876 ATACTCACCTGCCTGCTTTGTGG + Intergenic
1167422330 19:49411675-49411697 ATACAGAGCTGAGTCCCTTGGGG + Intronic
925057415 2:866031-866053 ATAAACACCTACATGCTTTGAGG + Intergenic
925383184 2:3442766-3442788 ATAGACAGATGGATGCATTGAGG + Intronic
925427424 2:3762303-3762325 TTCCACAGCCACATGCCTTGTGG - Intronic
931526396 2:63159837-63159859 ATCCACACATGCATACCTTGGGG + Intronic
931696140 2:64872005-64872027 GTACAAAGCTGCGTGCTTTGGGG + Intergenic
931755499 2:65370709-65370731 ATACACAGCTTTCTGTCTTGCGG + Intronic
933461780 2:82597122-82597144 GTGCACAGCTGCATGCCATAGGG + Intergenic
935271331 2:101436742-101436764 ACACACAGCTGCACACCATGGGG + Intronic
936754783 2:115694827-115694849 AAGCACAGCTGCCTGCCATGGGG - Intronic
937102510 2:119282696-119282718 AAACAGAGCTGCATCCCTGGAGG + Intergenic
938682235 2:133703513-133703535 TTTCCCAGCTGCATGCCCTGTGG - Intergenic
946532499 2:220587191-220587213 AAACACAGCTGCCTTCCTTGGGG - Intergenic
1169608287 20:7348893-7348915 ACAGCCAGCTGCATGCCCTGTGG - Intergenic
1170592518 20:17781697-17781719 AAACACAGATCCCTGCCTTGTGG + Intergenic
1173152541 20:40579996-40580018 AAACTCACCTGCATGCCTAGAGG + Intergenic
1176983430 21:15408891-15408913 AAACACAGTGGAATGCCTTGAGG + Intergenic
1177159138 21:17528973-17528995 ATGCACAGCTGTGTGGCTTGGGG + Intronic
1180075314 21:45458895-45458917 GGGCACAGCTGCATGGCTTGGGG + Intronic
952336868 3:32411102-32411124 ATTCACAGCTGTATCCCCTGCGG - Intronic
953404043 3:42651715-42651737 ACACACAGCTCCATGCCCTCCGG + Intergenic
953695361 3:45154089-45154111 AGACACAGCTTCCTGCCTTGAGG - Intergenic
955528587 3:59848156-59848178 ATGCACAGCTGCCTGCCATGGGG + Intronic
955792012 3:62597759-62597781 AAGCACAGCTGCAGGCCTGGTGG - Intronic
956968514 3:74492534-74492556 TAAAACAGCTGCATGCCCTGAGG + Intronic
963444595 3:145388035-145388057 ATGCACATCTGCCTGCCATGAGG - Intergenic
964484035 3:157169112-157169134 ATCCAAAGCTACATGACTTGAGG + Intergenic
966022363 3:175230874-175230896 TTACACAGGTGCATACCTTATGG + Intronic
968466015 4:751704-751726 ATCCACAGCTTCATGCCCTTTGG - Intronic
971889859 4:32506683-32506705 ATACAGGGCAGCATGTCTTGAGG - Intergenic
974035070 4:56810879-56810901 ATACAAAGCTGCATACCTGAAGG + Intronic
977294611 4:95197224-95197246 ATACACAGCTCCAGACATTGGGG + Intronic
977579607 4:98710724-98710746 ATGCACAGCTGCCTGCCATGGGG + Intergenic
981137720 4:141231315-141231337 ATAGACAGCTGCCTGTCTTTTGG - Intronic
981208661 4:142074433-142074455 GAACACATGTGCATGCCTTGTGG + Intronic
984601942 4:181737711-181737733 ATATACAGCGTCATGTCTTGTGG - Intergenic
986865090 5:11976803-11976825 AGACACAGATGCAAGCCTGGTGG - Intergenic
987638477 5:20578763-20578785 ATGCACAGCTGCCTGCCATAGGG - Intergenic
991213810 5:64137668-64137690 ATACACAGCTGCCTGCCATGAGG - Intergenic
991475063 5:67010488-67010510 GTACTCAGCTGCCTGCCTAGGGG - Intronic
992306652 5:75447087-75447109 ATGCACAGCTGCCTGCCACGGGG + Intronic
992958314 5:81933194-81933216 ATACACAGGGGCCTGTCTTGGGG - Intergenic
994492735 5:100468126-100468148 GTATACAGCTGCCTGCCATGTGG - Intergenic
994901696 5:105781200-105781222 ATACACAGCACCATGCAATGTGG + Intergenic
996410485 5:123153627-123153649 ATAAACTGCTACTTGCCTTGAGG - Intronic
996672864 5:126138811-126138833 TGACACAGCTGCATTCCTTGTGG + Intergenic
1000022870 5:157333689-157333711 AGACACAGCTGCATGTCCTTAGG + Intronic
1001883290 5:175264572-175264594 ATGCACAGCTGTCTGCCATGGGG - Intergenic
1001989021 5:176100657-176100679 ATACACAGCAGCAGGACATGTGG + Intronic
1002227849 5:177737479-177737501 ATACACAGCAGCAGGACATGTGG - Intronic
1005313443 6:24581368-24581390 AAACACAGCTCCATGACATGAGG + Intronic
1008772333 6:54993485-54993507 AAATACAGCTGAATGCTTTGAGG + Intergenic
1012300706 6:97584338-97584360 ATCCACAGTTGCAGTCCTTGTGG - Intergenic
1012500166 6:99879624-99879646 ATAAACAGCTGCTTGGGTTGTGG + Intergenic
1013002578 6:106038726-106038748 ATACACAGCTGCCTGCCATGGGG + Intergenic
1016101127 6:140101636-140101658 AAACACTGCTGCTTGCCTAGAGG - Intergenic
1017952081 6:159143723-159143745 AGGCACAGCTGCAGGCCTGGTGG + Intergenic
1018435747 6:163757380-163757402 ATACAAAGTTGAATGCATTGAGG - Intergenic
1020957537 7:14760618-14760640 ATACACAGATGCATACATTCTGG + Intronic
1021114060 7:16728933-16728955 ATGGGCAGCTGCCTGCCTTGAGG - Intergenic
1022211828 7:28218315-28218337 AGAAACAGGTGCAAGCCTTGTGG - Intergenic
1022441090 7:30433939-30433961 ATACATTGCAGCATGCATTGTGG + Intronic
1023906225 7:44523492-44523514 ATACACAGCTGCATGCCTTGAGG - Intronic
1026081285 7:67223747-67223769 GTACACAGCTGCCTGCCATGGGG + Intronic
1026695794 7:72590256-72590278 GTACACAGCTGCCTGCCATGGGG - Intronic
1031543304 7:123022715-123022737 ACAAACAGCTGCCTGCCATGTGG + Intergenic
1031560776 7:123235348-123235370 ATTCACAGCTGTATGACTTGTGG + Intergenic
1040428037 8:47308838-47308860 ATGCACAACTGCCTGCCTTGGGG + Intronic
1040468199 8:47714628-47714650 AGACACAGCTGCCCGCCTTGAGG + Intronic
1041294413 8:56339691-56339713 ATATGCAGATGCATGCCTTGGGG + Intergenic
1041792307 8:61710786-61710808 ATACACTGCTGATTGCATTGTGG - Intronic
1047288244 8:123506637-123506659 GGGCACAGCTGCATGCCTGGAGG - Intronic
1047555366 8:125923522-125923544 ATACCCTGCTCCCTGCCTTGGGG + Intergenic
1047579075 8:126192846-126192868 ATCAACAGGTGCATGCCTTGTGG + Intergenic
1049614975 8:143572116-143572138 GTACACGGCTGCCTGCCTGGAGG - Exonic
1051330905 9:16024135-16024157 AGACAGAGCTGCATTCCTTTGGG - Intronic
1053475435 9:38378880-38378902 ATTCCCAGCTGCCTGCATTGTGG - Intergenic
1053620885 9:39815077-39815099 CTACCCAGCTGCATGACCTGAGG + Intergenic
1054263277 9:62892365-62892387 CTACCCAGCTGCATGACCTGAGG - Intergenic
1056102358 9:83311924-83311946 ATTCACAGCTGCAGGCTTTGTGG - Exonic
1056461979 9:86817393-86817415 ATTCACAGCTGTTTGCCATGTGG - Intergenic
1057120268 9:92565501-92565523 GTGCACAGCTGCCTGCCCTGGGG - Intronic
1059573050 9:115460777-115460799 CTACAGAGCTGCATTCCTTCTGG - Intergenic
1060064407 9:120490585-120490607 CCACACAGCTACATGCCTTTGGG - Intronic
1188821717 X:34784009-34784031 ATACATATCTTCATTCCTTGAGG + Intergenic
1189384070 X:40522249-40522271 GGACACACATGCATGCCTTGGGG + Intergenic