ID: 1023906227

View in Genome Browser
Species Human (GRCh38)
Location 7:44523526-44523548
Sequence GCAGCTTGTACACAGCTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023906222_1023906227 21 Left 1023906222 7:44523482-44523504 CCACTCCCAGCCTCAAGGCATGC 0: 1
1: 0
2: 0
3: 54
4: 560
Right 1023906227 7:44523526-44523548 GCAGCTTGTACACAGCTTGCAGG No data
1023906219_1023906227 29 Left 1023906219 7:44523474-44523496 CCCATTTGCCACTCCCAGCCTCA 0: 1
1: 1
2: 2
3: 36
4: 340
Right 1023906227 7:44523526-44523548 GCAGCTTGTACACAGCTTGCAGG No data
1023906225_1023906227 11 Left 1023906225 7:44523492-44523514 CCTCAAGGCATGCAGCTGTGTAT 0: 1
1: 0
2: 3
3: 20
4: 151
Right 1023906227 7:44523526-44523548 GCAGCTTGTACACAGCTTGCAGG No data
1023906220_1023906227 28 Left 1023906220 7:44523475-44523497 CCATTTGCCACTCCCAGCCTCAA 0: 1
1: 0
2: 4
3: 39
4: 410
Right 1023906227 7:44523526-44523548 GCAGCTTGTACACAGCTTGCAGG No data
1023906224_1023906227 15 Left 1023906224 7:44523488-44523510 CCAGCCTCAAGGCATGCAGCTGT 0: 1
1: 0
2: 0
3: 29
4: 260
Right 1023906227 7:44523526-44523548 GCAGCTTGTACACAGCTTGCAGG No data
1023906223_1023906227 16 Left 1023906223 7:44523487-44523509 CCCAGCCTCAAGGCATGCAGCTG 0: 1
1: 0
2: 0
3: 42
4: 777
Right 1023906227 7:44523526-44523548 GCAGCTTGTACACAGCTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023906227 Original CRISPR GCAGCTTGTACACAGCTTGC AGG Intronic
No off target data available for this crispr