ID: 1023906470

View in Genome Browser
Species Human (GRCh38)
Location 7:44525799-44525821
Sequence ATATGCTGATAATCTTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 519
Summary {0: 1, 1: 2, 2: 11, 3: 73, 4: 432}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023906470_1023906474 14 Left 1023906470 7:44525799-44525821 CCTCAAAAAGATTATCAGCATAT 0: 1
1: 2
2: 11
3: 73
4: 432
Right 1023906474 7:44525836-44525858 CTTGAAGCCCAGATGGCAGTGGG No data
1023906470_1023906473 13 Left 1023906470 7:44525799-44525821 CCTCAAAAAGATTATCAGCATAT 0: 1
1: 2
2: 11
3: 73
4: 432
Right 1023906473 7:44525835-44525857 CCTTGAAGCCCAGATGGCAGTGG 0: 1
1: 0
2: 4
3: 65
4: 509
1023906470_1023906471 7 Left 1023906470 7:44525799-44525821 CCTCAAAAAGATTATCAGCATAT 0: 1
1: 2
2: 11
3: 73
4: 432
Right 1023906471 7:44525829-44525851 CAGAAACCTTGAAGCCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023906470 Original CRISPR ATATGCTGATAATCTTTTTG AGG (reversed) Intronic
903099440 1:21015680-21015702 TTCTGCTGATAATCTTATTGAGG - Intronic
905119007 1:35667336-35667358 AAATGATCAGAATCTTTTTGAGG - Intergenic
905830794 1:41065657-41065679 ATAAGCTGATTATATTTATGTGG - Intronic
906068092 1:42996743-42996765 ATATGTTCATAATCTTGTTTGGG + Intergenic
906181753 1:43826688-43826710 ATTTGCTAATAATTTTGTTGAGG - Intronic
906373721 1:45276705-45276727 ATGTGCTGATAACCTTATTGAGG - Intronic
906907001 1:49905799-49905821 ATATGCTTAATATATTTTTGAGG - Intronic
908017128 1:59854648-59854670 ATCTGCTGTTAATCTTATTAAGG + Intronic
908673317 1:66573293-66573315 AAATGCTTATAAACTGTTTGTGG + Intronic
908869618 1:68593966-68593988 ATATGCTTATTATCTTTTTCTGG + Intergenic
909878174 1:80837647-80837669 ATGTGCTGCTGATCTTTTTGGGG + Intergenic
910084753 1:83386673-83386695 ATCAGCTGACAATATTTTTGTGG - Intergenic
910272035 1:85406675-85406697 ATATACTGATCATTTATTTGTGG + Intronic
910325055 1:85997342-85997364 ATCTGCTAAAAATCTCTTTGGGG + Intronic
910529545 1:88219964-88219986 ATTTGATGATTCTCTTTTTGTGG - Intergenic
910545750 1:88415646-88415668 ATCTGATGACAATCTTATTGAGG - Intergenic
911032704 1:93507179-93507201 ATATGCTGATACATTGTTTGGGG - Intronic
911046804 1:93635554-93635576 ATTTGCAGAGAATGTTTTTGGGG + Intronic
911305499 1:96227149-96227171 ATATGCTGATTATCTTGTGAAGG - Intergenic
911673218 1:100630690-100630712 AGAAGCTGAAAATATTTTTGAGG + Intergenic
911806627 1:102217870-102217892 ATATACTGACTATATTTTTGTGG - Intergenic
912068279 1:105775096-105775118 ATCTGCTGATAATCTTTTTGAGG - Intergenic
912619616 1:111141501-111141523 AGGTGCTGATGTTCTTTTTGAGG + Intronic
913552838 1:119933559-119933581 ATATGCTGTTAATCTTATTGAGG - Intronic
916546419 1:165809438-165809460 ATATGCTGATCCTCTTTGTATGG - Intronic
916670117 1:167009941-167009963 ATATTCTCACATTCTTTTTGAGG + Intronic
917004128 1:170393795-170393817 ATCTACTGATAATCTTATTGAGG + Intergenic
917268321 1:173245571-173245593 ATATGTTTATCATCTATTTGTGG + Intergenic
918389613 1:184045015-184045037 ATATACTGAGAATTTTTATGAGG - Intergenic
918872981 1:190000793-190000815 AGAAGCTGATAATATTTTTTTGG + Intergenic
919131290 1:193453947-193453969 ATATACTTATCATTTTTTTGTGG - Intergenic
919441417 1:197638293-197638315 ATATGCTTATAGACTTTCTGAGG + Intronic
920962716 1:210678492-210678514 ATGAGCTGATACTATTTTTGTGG - Exonic
921987858 1:221331853-221331875 ATCTGCTGATAGTGTTATTGAGG - Intergenic
922965229 1:229684853-229684875 ATTGGCTGTTAATCTTATTGAGG + Intergenic
923249089 1:232162732-232162754 AAATGCTGTTGAACTTTTTGAGG - Intergenic
923607595 1:235458658-235458680 CTATGATGATATTGTTTTTGTGG - Exonic
923763338 1:236868884-236868906 ACATGCTGATAATTATTTAGAGG + Intronic
923940967 1:238826659-238826681 CTATGCTAATAATTTTTTTGAGG + Intergenic
923983583 1:239354016-239354038 ATATGTATATATTCTTTTTGGGG - Intergenic
924848563 1:247799455-247799477 ACATGCTTATCATATTTTTGTGG - Intergenic
1063069383 10:2645784-2645806 ATATTCTGATACTCTCTTTTTGG - Intergenic
1063549821 10:7020350-7020372 ATATGCTGATAGTCTTATAATGG - Intergenic
1064497364 10:15926560-15926582 ATTTGCTGATAATTTCATTGAGG + Intergenic
1064510816 10:16089085-16089107 TTGTGATGAGAATCTTTTTGGGG + Intergenic
1066992899 10:42533318-42533340 TTCTGCTGATGATCTTTTTGAGG - Intergenic
1067353205 10:45495961-45495983 GTCAGCTGTTAATCTTTTTGTGG - Intronic
1068145497 10:53064995-53065017 ATATTTTGATAATTTTATTGGGG + Intergenic
1068691742 10:59923093-59923115 ATATGCTGATAATGTTATTAAGG - Intergenic
1070046659 10:72844589-72844611 ATATTCTGAGGATATTTTTGCGG + Intronic
1070092918 10:73306480-73306502 ATCAGCTGTTAATCTTATTGAGG - Intronic
1070461074 10:76670917-76670939 ATATGGTGAAAATATTTTTAAGG + Intergenic
1071558846 10:86629600-86629622 ATATACTTATCATCTTTTTTTGG + Intergenic
1072074914 10:91960983-91961005 ATATACACATAATATTTTTGTGG + Intronic
1072339902 10:94437129-94437151 ATAAGCTGTTAATCTTATTGAGG + Intronic
1075178829 10:120191402-120191424 ACATGCTGATTCTCTTGTTGGGG - Intergenic
1075918785 10:126192220-126192242 AAATGAGGACAATCTTTTTGTGG + Intronic
1077582907 11:3428523-3428545 ATTCGCTGAAAATCTGTTTGTGG + Intergenic
1079528681 11:21421926-21421948 ATCTGCTGATAATCTTGTTGAGG - Intronic
1080127751 11:28756963-28756985 ATATTATGGTAATCTTTTTGGGG + Intergenic
1080177399 11:29381880-29381902 ATTTGCTGCTAATATTATTGAGG - Intergenic
1080259328 11:30329052-30329074 ATTTTCTGTAAATCTTTTTGGGG + Intronic
1080313459 11:30921855-30921877 AGTTGCTGAGAATCTTTTTGGGG + Intronic
1080777661 11:35401335-35401357 ATATGTTGAAAATATATTTGAGG + Intronic
1081047770 11:38297083-38297105 ATCAGCTATTAATCTTTTTGAGG - Intergenic
1084239816 11:67811333-67811355 ATTCGCTGAAAATCTGTTTGTGG + Intergenic
1084349313 11:68583644-68583666 ACCTGCTTATAATCTTTGTGGGG + Intronic
1084722861 11:70919250-70919272 ACATGCTGACCATCTTTTTGTGG + Intronic
1084832621 11:71781511-71781533 ATTCGCTGAAAATCTGTTTGTGG - Intergenic
1084985101 11:72862692-72862714 AAATCCTGATAGGCTTTTTGGGG + Intronic
1085473906 11:76776662-76776684 ATCTGCTGACAGTCTTATTGAGG + Intergenic
1086799468 11:91153358-91153380 CGTTACTGATAATCTTTTTGTGG - Intergenic
1086804891 11:91228372-91228394 AATTGATGATAATCTTTTGGTGG + Intergenic
1087040886 11:93798907-93798929 TTATGCTGATCATTTATTTGGGG - Intronic
1087748784 11:101981655-101981677 ATAATCTGAAAATTTTTTTGTGG + Intronic
1088472688 11:110203017-110203039 ATATAATGATTTTCTTTTTGGGG - Intronic
1088483684 11:110320705-110320727 ATTCCCAGATAATCTTTTTGTGG + Intergenic
1088998203 11:115022514-115022536 ATATGCTTATAATCTTATTGAGG - Intergenic
1091480384 12:823142-823164 ATCAGCTCATAATCTTATTGAGG + Intronic
1091504705 12:1055597-1055619 AGATGCTCATAATATTTTAGGGG + Intronic
1092828779 12:12423612-12423634 ATCTGTTGATAATCTTATTAAGG + Intronic
1093042503 12:14399935-14399957 ATATGCTGATAATTTGTCTTTGG + Intronic
1093355227 12:18158847-18158869 ATGTACTGATCAACTTTTTGTGG - Intronic
1093929530 12:24941644-24941666 ATATGATCAATATCTTTTTGGGG + Intronic
1094755002 12:33457763-33457785 ATCAGCTGATAGTCTTGTTGAGG - Intergenic
1095135239 12:38592995-38593017 AGAGCCTGTTAATCTTTTTGTGG - Intergenic
1095271884 12:40228067-40228089 ATATACTGATGTTCTTTTTTTGG + Intronic
1095699770 12:45178917-45178939 ATCTGCTGATAATCTACTGGAGG - Intergenic
1095728590 12:45479127-45479149 ATCTACTGATAATCTTATTGAGG - Intergenic
1096723011 12:53538184-53538206 ATATTATGATAATATTTTTCAGG + Intronic
1097299267 12:58000703-58000725 ATCTTCTGGTAATCTTATTGAGG + Intergenic
1098077041 12:66743198-66743220 ATTTGTTGAAAATATTTTTGGGG + Intronic
1098930815 12:76410634-76410656 ATATGCTGACTATTTTTTTAAGG - Exonic
1098967087 12:76802306-76802328 ATCTTCTGATAATCTTATTGAGG + Intronic
1099214368 12:79836233-79836255 ATGGGCTGATTATCTTTTGGTGG - Intronic
1099712063 12:86240763-86240785 ATATGTTGATAATTTTAATGTGG - Intronic
1099792559 12:87354933-87354955 ATATGATAATTATCTTTTTAGGG - Intergenic
1100928082 12:99573157-99573179 AGATGCTGAAAATCTGTTTGTGG - Intronic
1100974103 12:100103221-100103243 AGATTGTGATAAGCTTTTTGGGG - Intronic
1101831479 12:108261092-108261114 ATTGGCTGTTAATCTTATTGAGG - Intergenic
1101966222 12:109284045-109284067 TTAAGCTGTTAAACTTTTTGAGG - Intronic
1102087673 12:110156917-110156939 ATTTGCTGATGATCTTATTGAGG + Intronic
1103044699 12:117726296-117726318 ATATGGTGAACATCTTTTTTTGG - Intronic
1103995967 12:124830365-124830387 ATTTGTGGATAATCTTTGTGTGG - Intronic
1105904063 13:24786730-24786752 ATTTGCAGATAATATTATTGAGG + Intronic
1106371381 13:29137213-29137235 ATCTGCTGATAATCTTATTGAGG + Intronic
1107097092 13:36548654-36548676 TTATGATGAGAATATTTTTGAGG - Intergenic
1107201557 13:37725518-37725540 ATCTGTTGATAATCTTATTCAGG - Intronic
1107362173 13:39631361-39631383 ATCTGCTGTTAATCTTATTGAGG + Intergenic
1108176410 13:47797285-47797307 AAATGCTGATGCTCTATTTGTGG - Intergenic
1108191688 13:47947606-47947628 ATACAATGTTAATCTTTTTGTGG - Intronic
1108309867 13:49177699-49177721 ATATACTGGTACTCTTTTTATGG - Intronic
1109031402 13:57194511-57194533 ATATACTGATTTTCTTTTTGGGG + Intergenic
1109053890 13:57520711-57520733 ATCAGCTGTTAATCTTATTGTGG - Intergenic
1109083917 13:57945414-57945436 ATATGTTGTTAATCTTATTAAGG + Intergenic
1109485935 13:63019494-63019516 ATATGGTGCTAATATATTTGGGG - Intergenic
1109487256 13:63042446-63042468 AAATGCTGATAGTCTTTATGGGG + Intergenic
1110078508 13:71280883-71280905 ATATACTGATTTCCTTTTTGGGG + Intergenic
1110446619 13:75590253-75590275 ATATGCTTGCAATCTTATTGGGG - Intronic
1111303592 13:86376545-86376567 ATGTGCTGATTTTCTTTTTTTGG - Intergenic
1114411589 14:22505873-22505895 AGATTCTGAGTATCTTTTTGTGG + Intergenic
1114718202 14:24851204-24851226 CTATACTGACAATCTATTTGAGG + Intronic
1115080029 14:29439040-29439062 AAATGCTGCTAGTCTTTGTGGGG - Intergenic
1115970712 14:38941801-38941823 ATTTTCTGATCTTCTTTTTGAGG - Intergenic
1116698465 14:48205263-48205285 ATTTACAGATAATCTTTTTTTGG - Intergenic
1117765736 14:59080518-59080540 TTCTCCTGATAATCTTTTTTTGG - Intergenic
1117975720 14:61294789-61294811 ATATACTGATATTTTTTTTGCGG - Intronic
1118476373 14:66121185-66121207 TAATGATGATAACCTTTTTGAGG + Intergenic
1118750188 14:68801353-68801375 ATTTGCTGATAATCTCATTAAGG + Intergenic
1118884110 14:69852311-69852333 ATATGCTCATAAGCTTTTGAGGG + Intergenic
1120341604 14:83227007-83227029 ATTTACTGTTAATCTTTTTAGGG - Intergenic
1120367811 14:83592489-83592511 GCATGCTTATAATTTTTTTGTGG + Intergenic
1120816277 14:88862364-88862386 ATATTCTGATAATCCTTTCTTGG + Intronic
1121043271 14:90768089-90768111 ATCTGCTGATAATTTTATTGAGG - Intronic
1122527573 14:102398936-102398958 ATCTGCTTATAATCTTATTGGGG - Intronic
1124810712 15:32935325-32935347 ATCTTCTGATAGTCTTGTTGGGG + Intronic
1125109028 15:36008891-36008913 ATTGGCTGTTAATCTTATTGTGG - Intergenic
1125120168 15:36147199-36147221 ATCTGCTGATAATCTTATTGAGG - Intergenic
1125230446 15:37449144-37449166 CTATGGTGATGATCTGTTTGTGG + Intergenic
1126141456 15:45442810-45442832 ATATGGTGATAATCTAGCTGTGG - Intronic
1126453146 15:48832399-48832421 ATGTGCTGATAGTCTTATGGAGG + Intronic
1126617923 15:50604976-50604998 ATATGATAATCATGTTTTTGTGG - Exonic
1126751627 15:51883563-51883585 ACATACTGATCATTTTTTTGTGG + Intronic
1127737373 15:61856038-61856060 ATATGCTGATATTTTCTTTTTGG - Intronic
1127792684 15:62412304-62412326 AAGGGCTGATAACCTTTTTGAGG + Intronic
1128231475 15:66038508-66038530 ATAAGATTATAGTCTTTTTGCGG + Intronic
1128718071 15:69924240-69924262 AAATGCTGTTAATCTTTCTTTGG + Intergenic
1129013393 15:72443457-72443479 ATATGCATATAATCTATATGAGG - Intergenic
1129497837 15:76003714-76003736 ATCTGTTGATAATCTCATTGAGG - Intronic
1130572561 15:85061149-85061171 ATCTATTGATAATCTTATTGAGG + Intronic
1130718226 15:86358008-86358030 ACATACTTATAATTTTTTTGTGG + Intronic
1131350820 15:91698237-91698259 ATATGCAGAATGTCTTTTTGGGG - Intergenic
1131457355 15:92592631-92592653 ATATTTTTATAATCTTTGTGGGG + Intergenic
1132123976 15:99203977-99203999 ATATACTGATTTCCTTTTTGGGG + Intronic
1133351489 16:5103758-5103780 ATTCGCTGAAAATCTGTTTGTGG + Intergenic
1133666352 16:7971822-7971844 GTATGCAGATAAAATTTTTGAGG + Intergenic
1135068109 16:19328561-19328583 ATCTGCTGATAATCTTATTGAGG + Intergenic
1135606525 16:23830447-23830469 ATCTGCAGATAATCTTATTGAGG + Intergenic
1137354051 16:47741681-47741703 ATCAGCTGTTAATCTTATTGAGG + Intergenic
1139125220 16:64069695-64069717 ATATGCTGATAAACTGTTGGTGG - Intergenic
1139929144 16:70511383-70511405 ATGGTCTGATAATTTTTTTGTGG + Intronic
1140275650 16:73506385-73506407 ATATGCTGTTTATCTTAGTGGGG - Intergenic
1141084443 16:81081824-81081846 ATATGCTGATAATATTGGGGTGG - Intergenic
1143201920 17:5119154-5119176 AGAGTCTGATAATCTCTTTGAGG - Intronic
1145355547 17:22144603-22144625 ACATGCTGATAGTCTTTATGAGG - Intergenic
1145843877 17:28020745-28020767 ATATACTTATCATTTTTTTGGGG - Intergenic
1146046380 17:29511976-29511998 ATATGCTGATTATTTCTTTGTGG + Intronic
1148673064 17:49427211-49427233 AGATGAAGATAATCTTTTAGGGG - Intronic
1149405296 17:56343453-56343475 ATTAGCTGTTAATCTTTTTGAGG + Intronic
1150539700 17:66084318-66084340 ATATGCTGATTTTCTTTTTTTGG - Intronic
1150915533 17:69432860-69432882 ATTTGCTTATATTCTTTGTGAGG + Intronic
1151324839 17:73372871-73372893 ACATGTTCATCATCTTTTTGTGG + Intronic
1152504198 17:80736580-80736602 ATATGCATTTAATATTTTTGAGG - Intronic
1153067024 18:1057639-1057661 ATTTGCTAATAATTCTTTTGAGG + Intergenic
1153204243 18:2679586-2679608 ATTAGCTGTTAATCTTTTTGAGG + Intronic
1153214519 18:2807401-2807423 AGAAGCTGTTAATCTTATTGGGG - Intergenic
1153462485 18:5352049-5352071 AGGTGGTGATAATCATTTTGAGG + Intergenic
1155576347 18:27252002-27252024 ATATTCTCAAAATTTTTTTGAGG + Intergenic
1155666965 18:28321746-28321768 ATTTGCTGATAATTTTCTTATGG + Intergenic
1156236840 18:35213826-35213848 ATCAGCTGATAATCTTATTGAGG + Intergenic
1157821156 18:50770648-50770670 ATTTGTTGAGAATTTTTTTGTGG - Intergenic
1159520755 18:69518654-69518676 ATATGTTGATAATCTTTTCATGG + Intronic
1159576935 18:70190762-70190784 ATATGCAGTAAATCTGTTTGGGG - Intronic
1161369034 19:3899253-3899275 ATGAGCTGTTAACCTTTTTGGGG - Intronic
1161999623 19:7735045-7735067 ATGTGCTGATAACCATGTTGGGG - Intergenic
1164265152 19:23609052-23609074 ATCTGATGATTATGTTTTTGGGG + Intronic
1164946891 19:32302975-32302997 ATCTGCTGATAACCTTATGGGGG + Intergenic
1165345155 19:35241963-35241985 ATCTGCCAATAATCTTATTGAGG - Intergenic
1168456437 19:56513643-56513665 ATATTATGATAATATTTTTAAGG - Intronic
926406541 2:12558720-12558742 CTTTCCTGATAATCTCTTTGGGG - Intergenic
926529050 2:14018963-14018985 ATAAGCTGACAATTATTTTGTGG + Intergenic
926834905 2:17007883-17007905 AAAGGCTGATCCTCTTTTTGGGG + Intergenic
926878301 2:17510530-17510552 ATATGCATACAATCCTTTTGTGG - Intergenic
927072369 2:19544147-19544169 TTAGGCTCATGATCTTTTTGTGG + Intergenic
927315723 2:21678928-21678950 ATCTACTGATAATCTTATTAAGG - Intergenic
927631192 2:24775538-24775560 ATATGAGGATAATGTTTTTCAGG + Intergenic
928588935 2:32793179-32793201 ATCTGCTGATAATCTTATTAAGG - Intronic
928755268 2:34517004-34517026 ATTTTCAGATAATCATTTTGGGG - Intergenic
929065197 2:37965972-37965994 ATCTGCTGATGATTTTATTGAGG + Intronic
929354484 2:41003315-41003337 ATATGCTGCTAATATGTTAGAGG - Intergenic
929629999 2:43449804-43449826 ATTGGCTGATAATCTTATTCAGG - Intronic
931336846 2:61354280-61354302 ATTCGCTGATAATCTTATCGAGG - Intronic
931417562 2:62095720-62095742 ATCTGGTGATTATCCTTTTGAGG - Intronic
931458885 2:62433284-62433306 ATATGCTGATATGCAATTTGGGG - Intergenic
932551773 2:72777316-72777338 ATTTGCTGTTCATCTTATTGAGG - Intronic
933210199 2:79558068-79558090 ATATGCTGATAATCATAGTCTGG - Intronic
933313939 2:80693521-80693543 ATATGCAGGTCAGCTTTTTGAGG - Intergenic
933649259 2:84836408-84836430 ATCTGCTGTTAATCCTATTGGGG + Intronic
933933966 2:87185150-87185172 ATACACTGTTTATCTTTTTGTGG + Intergenic
935477186 2:103536893-103536915 AAATGCTTATAATCTGTTGGTGG - Intergenic
935610472 2:105018758-105018780 ATCTGCTGACCATCTTATTGAGG - Intergenic
936359177 2:111780745-111780767 ATACACTGTTTATCTTTTTGTGG - Intronic
937152287 2:119694416-119694438 ATATGCTGAGAATCTGGTGGGGG - Intergenic
937382633 2:121394464-121394486 ATGAGCTGTTAATCTTATTGAGG + Intronic
937558080 2:123184785-123184807 AGATGGTGATAATCTCATTGTGG - Intergenic
937565757 2:123285765-123285787 ATCAGCTGTTAATCTTATTGAGG - Intergenic
937596094 2:123675409-123675431 ATCTGCTCATTATCTTATTGAGG - Intergenic
937710245 2:124972504-124972526 ACATGCTGACCATGTTTTTGTGG + Intergenic
938944292 2:136197172-136197194 ATATACTGATTTCCTTTTTGGGG + Intergenic
939138463 2:138324421-138324443 CTATTCTTCTAATCTTTTTGTGG + Intergenic
940186386 2:150988797-150988819 ATTTGCTGATACTTGTTTTGTGG - Intergenic
940373756 2:152931916-152931938 ATATGCTGATGTACTTGTTGGGG + Intergenic
940386656 2:153081851-153081873 ATATTCTGATTTCCTTTTTGTGG + Intergenic
940405890 2:153301518-153301540 ATATATTTATTATCTTTTTGTGG + Intergenic
940591080 2:155728564-155728586 AGGTGCTGATAATGCTTTTGAGG - Intergenic
941221679 2:162788908-162788930 ATCTTCTGATAGTCTTATTGTGG - Intronic
941803889 2:169690759-169690781 ATTTGTTGTTAATCTTATTGAGG + Intronic
942545114 2:177055555-177055577 ATGTCCTGCTAATTTTTTTGTGG - Intergenic
943021503 2:182579915-182579937 ATGTGCTGATAGCATTTTTGGGG - Intergenic
943044630 2:182845329-182845351 ATTTCTTGATACTCTTTTTGGGG + Intronic
943545224 2:189267850-189267872 ATATGCCAAGAATCTTTTGGTGG - Intergenic
943673022 2:190685035-190685057 ATATGATGACAATATGTTTGGGG - Intronic
944789139 2:203106130-203106152 ATATGCTGATAAGATTAGTGAGG + Intronic
944973831 2:205024583-205024605 ATATGTTGATCAACTTTTTTTGG + Intronic
945112521 2:206375984-206376006 ATCTGCTGAAAATCTTATTGAGG + Intergenic
945237388 2:207644070-207644092 GTAAGCTGTTAATCTATTTGAGG - Intergenic
945576165 2:211531816-211531838 ATATACTGATTTCCTTTTTGGGG - Intronic
945951550 2:216043638-216043660 ATATACTGAGAATATTTTTCAGG + Intronic
949038773 2:241834920-241834942 ATATGCTGCTGTGCTTTTTGTGG + Intergenic
1168867618 20:1102216-1102238 ATCAGCTGTTAATCTTATTGGGG + Intergenic
1169585618 20:7080712-7080734 ATCAGCTGCTAATCTTATTGAGG + Intergenic
1170172415 20:13430110-13430132 AGATCCTGATTCTCTTTTTGGGG - Intronic
1170183543 20:13560989-13561011 ATCTGCTTATAATATTATTGGGG - Intronic
1170318235 20:15065888-15065910 TTATGCCAATAAACTTTTTGTGG - Intronic
1170657260 20:18299721-18299743 ATTTGCTAATAATCTTATTGAGG - Intronic
1170949010 20:20917915-20917937 ATCAGCTGATAATATTATTGAGG - Intergenic
1171402451 20:24884165-24884187 ATCTGCTAATAATGTTATTGAGG - Intergenic
1171478674 20:25435238-25435260 ATTTGGTGAAAATCTTATTGAGG + Intronic
1172627097 20:36353484-36353506 TTCTGCTGCTGATCTTTTTGAGG + Intronic
1172796758 20:37545040-37545062 AAATGCTGAAAACCTTTTTGTGG + Intergenic
1175588328 20:60165340-60165362 TTATGCTGATAATGGTATTGTGG + Intergenic
1176175248 20:63719123-63719145 ATTGGCTGTTAATCTTATTGAGG + Intronic
1177987863 21:28000621-28000643 ATATGCTTATTTTCATTTTGGGG - Intergenic
1181404423 22:22672624-22672646 ATATGATGAAAGTCTTCTTGAGG + Intergenic
1181413018 22:22738188-22738210 ATATGATGCAAATCTTCTTGAGG + Intronic
1185283971 22:49991569-49991591 ATCTGCTAAAAATCTTATTGAGG - Intergenic
949312717 3:2718199-2718221 ATATGGTGATAATATATATGAGG - Intronic
949389983 3:3550506-3550528 ATTTTCTGCTAATCTTATTGTGG + Intergenic
949695585 3:6690564-6690586 ATGTGCTGAAACTCTTTTTTGGG - Intergenic
951835127 3:26974801-26974823 ATAGGCTCATACTCTTTTTTTGG - Intergenic
951870936 3:27361485-27361507 ATATACTCATATTCTATTTGGGG - Intronic
951902095 3:27666943-27666965 ACATGCTGCCACTCTTTTTGTGG + Intergenic
952460405 3:33519153-33519175 CAATTCTGATAATATTTTTGTGG + Intronic
952460772 3:33523445-33523467 ATCTGCTGATAATCTTACTGAGG - Intronic
954319901 3:49825033-49825055 ATATTCTGAGTATTTTTTTGTGG + Intergenic
954588753 3:51761549-51761571 ATATACTGATAGTCTTATGGGGG + Intergenic
955528484 3:59846935-59846957 ATCTGCTGATAATCTTAGTGAGG + Intronic
955625545 3:60914700-60914722 ATATGTTCATAAGCTATTTGTGG + Intronic
956546040 3:70404232-70404254 GTTTGCTCATATTCTTTTTGGGG + Intergenic
957527433 3:81395216-81395238 ATATGCTAATAATATGTCTGGGG + Intergenic
957681513 3:83441445-83441467 CTAAGGTGATGATCTTTTTGTGG - Intergenic
958496661 3:94852143-94852165 ATCTGCTGATATTCTTATTGAGG - Intergenic
959952568 3:112196253-112196275 ATCTGCTATTAATCTTATTGAGG + Intronic
960785340 3:121367504-121367526 ATATGCTGATTATCTTATTAAGG + Intronic
961299097 3:125910610-125910632 ATTCGCTGAAAATCTGTTTGTGG - Intergenic
962636906 3:137340541-137340563 ATATTCTGATCATCTTATTCTGG + Intergenic
963200852 3:142584535-142584557 ATATGCTGATAATCATTGATTGG - Intergenic
963290873 3:143486057-143486079 ATCTGCTGATAATCTTGTTAAGG - Intronic
963384504 3:144573730-144573752 ATATAATGTTAATCTTTTTGAGG + Intergenic
963711487 3:148752577-148752599 ATATCCTGAAAGTCTGTTTGTGG - Intergenic
964348822 3:155782529-155782551 ATCTGCAGATAATCTTATTAAGG - Intronic
964931223 3:162026429-162026451 ATATACTTATAATTTTTGTGTGG + Intergenic
965250384 3:166336019-166336041 ATATTCTGATTATTTTTTTCAGG + Intergenic
965393841 3:168137210-168137232 TTATTTTGATAATCATTTTGTGG + Intergenic
966143031 3:176777906-176777928 ATATACTGATTATTTTCTTGTGG + Intergenic
966630681 3:182070954-182070976 TTTTACTGATAATCTTTTTAAGG + Intergenic
966903209 3:184502307-184502329 ATCTGCTAGTAATCTTATTGAGG + Intronic
967196533 3:187031136-187031158 TTATGCTGATCATCTCTGTGAGG + Intronic
967650570 3:191980613-191980635 ATCAGCTGTTAATCTTATTGAGG - Intergenic
967662842 3:192134303-192134325 ATATGCTGTTAATAATTTGGGGG + Intergenic
968246553 3:197155206-197155228 GTCTGCTGATAATCTCATTGAGG - Intronic
968379362 4:76810-76832 ATTTGCTGATAACCTTATAGGGG + Intronic
969965677 4:10992905-10992927 ATAAGCTGATAATCGCTTAGTGG + Intergenic
970069458 4:12140657-12140679 TAATTCTCATAATCTTTTTGAGG - Intergenic
971295408 4:25385163-25385185 ATAAGCTGATTCTCTTTTTAGGG - Intronic
971718426 4:30212408-30212430 ATCTGCTCATGATCTTTTTTAGG + Intergenic
971729906 4:30364097-30364119 CAATCCTGATAATCATTTTGGGG + Intergenic
971735373 4:30443009-30443031 ATATGATTATGTTCTTTTTGTGG + Intergenic
972111324 4:35562868-35562890 ATATACTGACAATTTCTTTGTGG - Intergenic
972161873 4:36237242-36237264 ATTTGCTAATAAACTTATTGTGG + Intronic
973589960 4:52431095-52431117 AATTGCTTATAATCTTTTAGAGG - Intergenic
973666843 4:53168727-53168749 AAATACTAATAATTTTTTTGTGG + Intronic
974292761 4:59954836-59954858 ATATACTGATATCCTTTTTGGGG - Intergenic
974813095 4:66971326-66971348 AAATGCTGACAATTTTTTGGTGG - Intergenic
974843768 4:67326553-67326575 ATATGCACATCATCTTTATGTGG - Intergenic
975418351 4:74132917-74132939 ATATGCTAATAATTTAATTGTGG - Intronic
975615300 4:76240258-76240280 ATCTGCAGATAATCTTATTGAGG + Intronic
976374858 4:84334234-84334256 ATATACTGATATTTGTTTTGTGG + Intergenic
976631629 4:87243566-87243588 ATTGGCTGTTAATCTTATTGAGG - Intergenic
977069448 4:92365788-92365810 ATATGCTGATTATTTATTTTTGG - Intronic
977114497 4:93006163-93006185 TTATGCTAAAAATGTTTTTGTGG - Intronic
977399552 4:96514759-96514781 ATATGCTGATTTCCTTTTTTGGG - Intergenic
977451636 4:97206554-97206576 TTATACTGAGAATATTTTTGAGG - Intronic
977993408 4:103473133-103473155 ATATGCATATCTTCTTTTTGAGG + Intergenic
978419054 4:108510816-108510838 ATATGATAAGAATCTTTCTGAGG - Intergenic
979374540 4:119930561-119930583 ATTTGCTGATAACCTTCTTGAGG + Intergenic
979384128 4:120043893-120043915 ATCTGCTGATAATCTTATTGAGG - Intergenic
979784093 4:124693212-124693234 ATTAGCTGAAAATATTTTTGTGG + Intronic
979949270 4:126872609-126872631 GTATGCTGTTAATTTTATTGAGG - Intergenic
980417269 4:132507768-132507790 ATTTACTGAATATCTTTTTGGGG - Intergenic
980957016 4:139439397-139439419 ATCTGCTGATAATCTTATTGAGG + Intergenic
981035721 4:140166920-140166942 ACATGCTTATTATTTTTTTGTGG - Intergenic
981667957 4:147251706-147251728 ATTGGCTGTTAATCTTATTGAGG - Intergenic
981825522 4:148936225-148936247 ATATTCTGATAATGAATTTGGGG + Intergenic
982799742 4:159689599-159689621 ACCTGCTAATAATCTTATTGAGG - Intergenic
983109412 4:163729784-163729806 ATCTGCTGATAACCTTATTGAGG + Intronic
983444467 4:167832134-167832156 AAATGCTGAGAATCTATTTGGGG - Intergenic
983636676 4:169904701-169904723 ATTTGCTGAAAATGTTTTTCTGG + Intergenic
984331152 4:178320571-178320593 ATAGGCTTATAATCTTATTGAGG - Intergenic
984415547 4:179453583-179453605 ACCTGCTGATAATCTTATTAAGG - Intergenic
984567117 4:181344359-181344381 ATATGCTGATAAAGTTTGAGGGG + Intergenic
985045961 4:185940560-185940582 ATATGCTGAGAAGCTATTAGAGG - Intronic
985482617 5:125960-125982 ATATGCCGACAATCTTATTAAGG + Intergenic
985533910 5:451917-451939 ATCTGCTCATAATCTTATTTTGG + Intronic
986454870 5:7907430-7907452 ATTTGTTGATACTTTTTTTGTGG + Intergenic
986744630 5:10732713-10732735 AAATGCTGTTTAGCTTTTTGAGG + Intronic
987823598 5:22998205-22998227 GTATACTGATTTTCTTTTTGTGG - Intergenic
989504211 5:42207915-42207937 ATATACTGATTTTCTTTTTGGGG + Intergenic
990125793 5:52516424-52516446 ATATGATTAAAATTTTTTTGTGG - Intergenic
990292989 5:54373697-54373719 ATTTGCTGATAATCTAATTGAGG + Intergenic
990652276 5:57915150-57915172 ATATTCTGATACTCTTTCTTGGG + Intergenic
991213911 5:64138925-64138947 ATTTGCTGATAATTTTATTGAGG - Intergenic
992051449 5:72944653-72944675 ACATACTTATAATTTTTTTGTGG + Intergenic
992432348 5:76721352-76721374 ATATACTGAGAATTTTTTTCTGG + Intronic
993334223 5:86637072-86637094 CTAAGCTAATTATCTTTTTGTGG + Intergenic
993379693 5:87192209-87192231 ATATGTGGATATTCTGTTTGGGG - Intergenic
993891493 5:93480299-93480321 ATAGGTTGTTAATCTTATTGAGG - Intergenic
994085009 5:95748921-95748943 ATATCCTCCTAATCTTGTTGTGG + Intronic
994105381 5:95941846-95941868 ACATGCTGATTTTCTATTTGAGG - Intronic
994243087 5:97446994-97447016 ATATCCTGATAATAATTTTTGGG - Intergenic
994888019 5:105591599-105591621 ATTTTCTTATAATTTTTTTGTGG - Intergenic
995346119 5:111120115-111120137 ATATGCTGAGCATATTCTTGTGG - Intronic
995970193 5:117959744-117959766 ATCTGCTGATAATTTATTTGAGG - Intergenic
996517216 5:124383854-124383876 ATCTGATGATAATCTTATAGAGG - Intergenic
996931164 5:128890028-128890050 ATATGCTGATTTCCTTTTTGGGG + Intronic
997576576 5:134982479-134982501 ATCGGCTGTTAATCTTATTGAGG - Intronic
997915121 5:137916853-137916875 ATATGCTGATAATCTTCTTGAGG + Intronic
998089312 5:139354375-139354397 ATCAGCTGTTAATCTTATTGAGG + Intronic
998663625 5:144269372-144269394 ATCTGCTGATAATCATATGGAGG - Intronic
999037897 5:148374021-148374043 CTATGTTGATAAACATTTTGAGG - Intergenic
999543695 5:152602925-152602947 GTGTGCTCTTAATCTTTTTGAGG + Intergenic
999918604 5:156291844-156291866 ATATGCTTATCATTTATTTGTGG + Intronic
1000497035 5:161997245-161997267 ATATACTGATTTCCTTTTTGGGG - Intergenic
1000566869 5:162858926-162858948 GTCTGCTGTTAATCTTATTGAGG - Intergenic
1001418642 5:171569267-171569289 ATGTGTTGATAATCTCATTGAGG + Intergenic
1002614785 5:180444744-180444766 ATCAGCTGTTAATCTTATTGAGG + Intergenic
1003834268 6:10051390-10051412 ATCTGCTGATAATTTTCTTGAGG - Intronic
1005122304 6:22403081-22403103 ACATGATTATAATCTTTTTTGGG + Intergenic
1006477712 6:34268558-34268580 ATCTACTAATAATCTTTATGAGG + Intergenic
1006660464 6:35638246-35638268 ATCTGATGAACATCTTTTTGGGG + Intronic
1006690619 6:35880976-35880998 ACTTGCTGATAATCTTAGTGAGG - Intronic
1006889888 6:37417565-37417587 ATCAGCTGTTAATCTTATTGAGG + Intergenic
1008181057 6:48329772-48329794 ATATACTGAAATTCATTTTGAGG + Intergenic
1008313125 6:50003015-50003037 AAATGCTGTTACTATTTTTGTGG + Intergenic
1008447049 6:51604913-51604935 ATATGTTTATAATCTACTTGAGG + Intergenic
1008975996 6:57427674-57427696 TTATAGTGATAATTTTTTTGGGG + Intronic
1009031986 6:58070235-58070257 AAACACTGATAATGTTTTTGGGG - Intergenic
1009207812 6:60824687-60824709 AAACACTGATAATGTTTTTGGGG - Intergenic
1010566505 6:77420969-77420991 ACATGCTTATCTTCTTTTTGTGG - Intergenic
1010883660 6:81210781-81210803 ATATGCTGATATTCCTTCTTTGG - Intergenic
1011752665 6:90468972-90468994 ATTTACTGATAAGCTTTTAGTGG - Intergenic
1011936580 6:92786154-92786176 ATATGCTGATAAATTATTTCAGG - Intergenic
1012057159 6:94427599-94427621 ATCTGCTGATAATCTTATGGAGG + Intergenic
1012603470 6:101127918-101127940 AGATGAGGATAATATTTTTGAGG + Intergenic
1013259341 6:108425111-108425133 ATATGTAGAAACTCTTTTTGAGG + Intronic
1015130258 6:129801665-129801687 CTATGATGATATTGTTTTTGTGG + Intergenic
1015392312 6:132696592-132696614 ATCTGCCGATAATCTTATTGGGG - Intronic
1015393260 6:132707451-132707473 ATATACTGATTTTCTTTTTGAGG - Intronic
1016192910 6:141293279-141293301 ATATGCTGATGGTATTTTAGTGG + Intergenic
1018567872 6:165175376-165175398 ATCAGCTGTTAATATTTTTGAGG - Intergenic
1019871988 7:3772897-3772919 ATCTGCTGATAATTTTATTGAGG + Intronic
1020658843 7:10959182-10959204 TGATGCTGTTAATGTTTTTGTGG + Intergenic
1021563717 7:21995262-21995284 ATATACTTATCATTTTTTTGAGG - Intergenic
1022825422 7:34006997-34007019 ATTTTCTGAGAATCTTTTTCTGG + Intronic
1022883363 7:34614289-34614311 ATATGCTGATAATATTATTGAGG - Intergenic
1023906470 7:44525799-44525821 ATATGCTGATAATCTTTTTGAGG - Intronic
1023910182 7:44549083-44549105 ATCAGCTGATAATCTTATTGAGG - Intergenic
1024376372 7:48643055-48643077 ACTTGCTGATAATTTTTTTAAGG + Intronic
1024480687 7:49858945-49858967 ATATTCTGATAAACTCTGTGGGG - Intronic
1025825205 7:65005349-65005371 ATATTCTGATAAGGTTTCTGTGG + Intronic
1026303489 7:69119755-69119777 ATATACTGAGGACCTTTTTGGGG - Intergenic
1026710722 7:72736910-72736932 ATATTATGAATATCTTTTTGAGG + Intronic
1027301574 7:76842786-76842808 ATCAGCTGACAATATTTTTGTGG - Intergenic
1027909299 7:84228493-84228515 CTTTGCTGTTAATCATTTTGTGG - Intronic
1028008102 7:85604231-85604253 ATATACTGATTTTCTTTTTTTGG + Intergenic
1028032995 7:85941596-85941618 ATTTGCTGATAGTCATTTTCAGG - Intergenic
1028805337 7:95019641-95019663 CTATGCTAATCATCTTTTTATGG - Intronic
1029245598 7:99198101-99198123 ATCAGCTGTTAATCTTATTGAGG - Intronic
1029272072 7:99383158-99383180 ATGTAATGATAATATTTTTGAGG + Intronic
1030255195 7:107502715-107502737 ATAAGCTGATAATCTCACTGTGG + Intronic
1030449100 7:109686635-109686657 AAATGATTATAAGCTTTTTGAGG + Intergenic
1030478371 7:110068699-110068721 ATATACTGATTTCCTTTTTGCGG + Intergenic
1030963101 7:115951701-115951723 TGATGCTGATACTGTTTTTGTGG + Intronic
1031543214 7:123021425-123021447 ATCTGCTGATAATCTTATTAAGG + Intergenic
1031782954 7:125993365-125993387 ATATGCTGAGACTTGTTTTGTGG + Intergenic
1031787171 7:126047198-126047220 ATATACTGATTTCCTTTTTGGGG - Intergenic
1032594637 7:133227235-133227257 ATATGGTTATAATATTTTTGAGG + Intergenic
1032605947 7:133353504-133353526 ATCTGTGGATAATCTTATTGGGG + Intronic
1033488234 7:141812884-141812906 CTTTCCTGATTATCTTTTTGAGG - Intergenic
1033890042 7:146000889-146000911 GTATGCTGCTAAGATTTTTGTGG - Intergenic
1034607510 7:152330918-152330940 TTATTTTGATAATCATTTTGCGG - Intronic
1034637029 7:152575668-152575690 AGATGCTGAGAGTCTGTTTGAGG - Intergenic
1036555150 8:9853079-9853101 ACATGCAGATAATCTTTGAGGGG + Intergenic
1036575126 8:10020644-10020666 AAATGCTCTTAATGTTTTTGAGG + Intergenic
1036792061 8:11727438-11727460 TTTTGCTTATAATCTTTATGGGG + Intronic
1037187684 8:16083670-16083692 ATATACTCATCATATTTTTGTGG + Intergenic
1037938751 8:22933450-22933472 ATTGGCTGATAATTTTATTGAGG - Intronic
1038078038 8:24100241-24100263 AGACGCTAATAATCTTTTGGAGG - Intergenic
1038108968 8:24473019-24473041 ATCTGCTGTAAATCTTTTTGGGG - Intronic
1038876454 8:31555887-31555909 ATCTTCTGATAATCTTATTTAGG - Intergenic
1039662173 8:39479600-39479622 GTATGCTGAAAATCATCTTGGGG - Intergenic
1040441915 8:47452200-47452222 ATAAGCTGTTAATATTATTGAGG - Intronic
1040675741 8:49747522-49747544 ATCTGCTCATAATCTGATTGAGG - Intergenic
1040744448 8:50623573-50623595 ACATTCTGAAAATGTTTTTGTGG - Intronic
1040826720 8:51629701-51629723 ATCTGCTGTTAATCTTACTGTGG - Intronic
1041186854 8:55309893-55309915 ATTTGCTGCTAATCATTTAGAGG + Intronic
1042287067 8:67125314-67125336 ATAAGCTGTTAATCTTACTGAGG + Intronic
1043008061 8:74845304-74845326 ATATGCTAATACTATTTTGGTGG + Intronic
1043090511 8:75896045-75896067 AGAGGCTGAGAATTTTTTTGAGG + Intergenic
1043104886 8:76095593-76095615 ATCTACTGTTAATCTTATTGTGG + Intergenic
1043131593 8:76469776-76469798 ATTTGCTGAGGATCTTTTTGTGG + Intergenic
1043292911 8:78626226-78626248 ATATACTGATTTTCTTTTTTTGG + Intergenic
1043569356 8:81584809-81584831 ATTAGATAATAATCTTTTTGAGG + Intergenic
1043674974 8:82939559-82939581 ATTTGCTGATAATTGTTTTATGG - Intergenic
1043823693 8:84899456-84899478 AAATGCTCATAATATGTTTGAGG - Intronic
1044019028 8:87081841-87081863 ATAGGCTGATAATGTTGTTCAGG + Intronic
1044073629 8:87792472-87792494 ATATGCCAATAATCTGATTGAGG - Intergenic
1044943423 8:97366921-97366943 ATTGGCTGATAATCTTACTGAGG - Intergenic
1045352989 8:101359580-101359602 AAAAGCTGGTAATATTTTTGTGG - Intergenic
1047811725 8:128417813-128417835 ATGTACTGATAATTTGTTTGGGG - Intergenic
1048319940 8:133390906-133390928 AAAAGTTGATAAACTTTTTGTGG + Intergenic
1048391857 8:133974475-133974497 ATATGCTGAGAAACTTTTAATGG + Intergenic
1048684870 8:136893316-136893338 ATATACTGATATTCTTTTCTAGG - Intergenic
1049938355 9:521224-521246 ACATGTTGAGATTCTTTTTGTGG + Intronic
1051563235 9:18466510-18466532 ATATACTTATGATTTTTTTGTGG - Intergenic
1051782202 9:20701858-20701880 ATATGCTGATAAGCTGCTTTGGG + Intronic
1052551085 9:29950265-29950287 ATTTGCTGAGAATCATTTTGTGG + Intergenic
1052565488 9:30144876-30144898 GTATGTTGTTAATCATTTTGGGG - Intergenic
1052671461 9:31562686-31562708 ATATGATCTTATTCTTTTTGTGG - Intergenic
1052780250 9:32775458-32775480 ATCTGCTGATAGTCTTTTGCAGG + Intergenic
1053058645 9:35010529-35010551 ATCAGCTGTTAATCTTATTGAGG - Intergenic
1053193752 9:36098224-36098246 ACATACTTATAATTTTTTTGTGG - Intronic
1055342065 9:75294235-75294257 ATATGCTGATTTCCTTTTTGGGG + Intergenic
1055704780 9:78985963-78985985 TTACCCTGATATTCTTTTTGGGG + Intergenic
1055916373 9:81404944-81404966 TTATGCAAATATTCTTTTTGTGG + Intergenic
1056102164 9:83310333-83310355 ATATGCTAAAAATATTTTAGAGG - Intronic
1056241221 9:84648465-84648487 ATATGCTTAACATTTTTTTGTGG + Intergenic
1056906296 9:90651437-90651459 CTCTGCTGATAATCTTATTGGGG - Intergenic
1057079913 9:92165936-92165958 ATATGCTGATAATTTCCTTGAGG - Intergenic
1057097905 9:92328828-92328850 ATATGCAGATTTTCTTTTTGTGG + Intronic
1058005488 9:99909469-99909491 ATATAAAGATAATCTCTTTGTGG + Intronic
1058786034 9:108388478-108388500 ATAAGCTGATAAAATTTCTGTGG + Intergenic
1059139573 9:111840086-111840108 ACATGCTAATAATTTTTTTGTGG + Intergenic
1059594501 9:115703935-115703957 ATGTGTTGTTAGTCTTTTTGTGG - Intergenic
1060325698 9:122612613-122612635 ATAACCAAATAATCTTTTTGAGG - Intergenic
1185623922 X:1469348-1469370 ACATGGTGAAACTCTTTTTGGGG - Intronic
1186375855 X:8999550-8999572 ATCTGCTGATAATTGTATTGAGG + Intergenic
1186917231 X:14236281-14236303 ATCTGCTGATAATTTTATTGAGG - Intergenic
1187120625 X:16402706-16402728 AAAAGCTGATAATCTTTATTTGG - Intergenic
1187780244 X:22813476-22813498 ATATACTTATCATTTTTTTGTGG - Intergenic
1187975950 X:24705540-24705562 ATATCATGATAATGTTATTGTGG - Intronic
1188745219 X:33833077-33833099 ATATACTGATTTTCTTTTTCGGG + Intergenic
1188807013 X:34603696-34603718 TTATGCTGAATATATTTTTGTGG - Intergenic
1188885507 X:35545206-35545228 ATATGCTGATAATCTTATCATGG + Intergenic
1188977967 X:36698464-36698486 AGCTGCTGCTAATCTTATTGAGG + Intergenic
1190018536 X:46850761-46850783 AGATGCTGAGAATATTTTGGAGG - Intronic
1191699870 X:64030089-64030111 ATCTGCTGATAATCTTATTGAGG + Intergenic
1191733141 X:64359257-64359279 CTATTCTAATAATCTTTTTATGG - Intronic
1191747344 X:64503616-64503638 ATTTGCTGATAATTGTTTTATGG - Intergenic
1192040475 X:67615353-67615375 ATCAGCTGTTAATCTTATTGTGG - Intronic
1192070122 X:67930004-67930026 ATATACTGATTTCCTTTTTGGGG - Intergenic
1192246435 X:69376142-69376164 ATCAGCTGATAATCTTACTGAGG - Intergenic
1192715218 X:73633390-73633412 ATCTGCTGATTTTCTTATTGGGG + Intronic
1193658562 X:84227877-84227899 GTATGCTTATAATCTGTGTGAGG + Intergenic
1193706625 X:84828251-84828273 ATATGCTGATAATATTATTGAGG + Intergenic
1193714265 X:84919259-84919281 ATATGATTTTACTCTTTTTGTGG - Intergenic
1194024190 X:88731163-88731185 ATATACTGATTTTCTTTTTTGGG - Intergenic
1194336011 X:92646954-92646976 TTCAGCTGTTAATCTTTTTGGGG + Intergenic
1194376561 X:93141507-93141529 ATCTGCTGTTAATCTTATTGAGG + Intergenic
1194380510 X:93185209-93185231 ATATACTAATAATTTGTTTGGGG - Intergenic
1194388030 X:93281140-93281162 ATATGCTGATCTCCTTTTTTGGG - Intergenic
1194575162 X:95604013-95604035 ATATACTAATTTTCTTTTTGGGG - Intergenic
1195488978 X:105443824-105443846 ATATACTGATTTCCTTTTTGGGG + Intronic
1196154526 X:112413360-112413382 ATATACTGATTTCCTTTTTGGGG - Intergenic
1196369154 X:114956461-114956483 ATATGTTGATAAGCTGTTGGGGG + Intergenic
1196502955 X:116407058-116407080 ACATGCTGATCATTTTTTTGTGG + Intergenic
1196587048 X:117442147-117442169 ATTTGCTGATAATTGTTTTATGG - Intergenic
1197090722 X:122533171-122533193 ATATACTGATTTCCTTTTTGAGG - Intergenic
1197259489 X:124302739-124302761 ATTGGCCGTTAATCTTTTTGAGG + Intronic
1197398529 X:125959167-125959189 GTCTGTTGACAATCTTTTTGAGG - Intergenic
1197577359 X:128231910-128231932 ATCTGTTGATAAACTTATTGAGG - Intergenic
1197662006 X:129184448-129184470 ATATACACATATTCTTTTTGGGG - Intergenic
1197710406 X:129662540-129662562 AGATCCTAATAATCATTTTGAGG + Intergenic
1198945237 X:142004806-142004828 ATCTGCTGTTAATATTATTGAGG + Intergenic
1199118110 X:144016468-144016490 TTATGCAGATATACTTTTTGAGG + Intergenic
1199921754 X:152413141-152413163 TTCAGCTGATAATCTTATTGAGG - Intronic
1199931006 X:152521911-152521933 ATAAGCTGTTAATCTTATTGAGG - Intergenic
1200021629 X:153215940-153215962 ATAAGCTTAAAATATTTTTGTGG - Intergenic
1200644443 Y:5763702-5763724 TTCAGCTGTTAATCTTTTTGGGG + Intergenic