ID: 1023906474

View in Genome Browser
Species Human (GRCh38)
Location 7:44525836-44525858
Sequence CTTGAAGCCCAGATGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023906470_1023906474 14 Left 1023906470 7:44525799-44525821 CCTCAAAAAGATTATCAGCATAT 0: 1
1: 2
2: 11
3: 73
4: 432
Right 1023906474 7:44525836-44525858 CTTGAAGCCCAGATGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023906474 Original CRISPR CTTGAAGCCCAGATGGCAGT GGG Intronic
No off target data available for this crispr