ID: 1023909102

View in Genome Browser
Species Human (GRCh38)
Location 7:44541246-44541268
Sequence AGACCTGGGATGGCGGAGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 541
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 494}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023909102_1023909115 -5 Left 1023909102 7:44541246-44541268 CCGGCCTCCGCCATCCCAGGTCT 0: 1
1: 0
2: 4
3: 42
4: 494
Right 1023909115 7:44541264-44541286 GGTCTGGGAAGGGGTCAGCGGGG 0: 1
1: 0
2: 3
3: 38
4: 357
1023909102_1023909116 2 Left 1023909102 7:44541246-44541268 CCGGCCTCCGCCATCCCAGGTCT 0: 1
1: 0
2: 4
3: 42
4: 494
Right 1023909116 7:44541271-44541293 GAAGGGGTCAGCGGGGAGCCAGG 0: 1
1: 0
2: 1
3: 26
4: 413
1023909102_1023909118 14 Left 1023909102 7:44541246-44541268 CCGGCCTCCGCCATCCCAGGTCT 0: 1
1: 0
2: 4
3: 42
4: 494
Right 1023909118 7:44541283-44541305 GGGGAGCCAGGCCAGGCCTCAGG 0: 1
1: 0
2: 6
3: 102
4: 715
1023909102_1023909113 -7 Left 1023909102 7:44541246-44541268 CCGGCCTCCGCCATCCCAGGTCT 0: 1
1: 0
2: 4
3: 42
4: 494
Right 1023909113 7:44541262-44541284 CAGGTCTGGGAAGGGGTCAGCGG 0: 1
1: 0
2: 4
3: 55
4: 560
1023909102_1023909122 26 Left 1023909102 7:44541246-44541268 CCGGCCTCCGCCATCCCAGGTCT 0: 1
1: 0
2: 4
3: 42
4: 494
Right 1023909122 7:44541295-44541317 CAGGCCTCAGGAACAGCCAAGGG 0: 1
1: 0
2: 2
3: 29
4: 255
1023909102_1023909114 -6 Left 1023909102 7:44541246-44541268 CCGGCCTCCGCCATCCCAGGTCT 0: 1
1: 0
2: 4
3: 42
4: 494
Right 1023909114 7:44541263-44541285 AGGTCTGGGAAGGGGTCAGCGGG 0: 1
1: 1
2: 2
3: 44
4: 374
1023909102_1023909121 25 Left 1023909102 7:44541246-44541268 CCGGCCTCCGCCATCCCAGGTCT 0: 1
1: 0
2: 4
3: 42
4: 494
Right 1023909121 7:44541294-44541316 CCAGGCCTCAGGAACAGCCAAGG 0: 1
1: 1
2: 4
3: 34
4: 435
1023909102_1023909117 7 Left 1023909102 7:44541246-44541268 CCGGCCTCCGCCATCCCAGGTCT 0: 1
1: 0
2: 4
3: 42
4: 494
Right 1023909117 7:44541276-44541298 GGTCAGCGGGGAGCCAGGCCAGG 0: 1
1: 1
2: 3
3: 62
4: 484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023909102 Original CRISPR AGACCTGGGATGGCGGAGGC CGG (reversed) Exonic
900138451 1:1128734-1128756 GGTCCTGGGAGGGCGGAGGGCGG - Intergenic
900529207 1:3144491-3144513 GGAGCTGGGAAGGCAGAGGCTGG - Intronic
900792445 1:4689427-4689449 AGGCCCAGGAAGGCGGAGGCGGG + Intronic
901634384 1:10663831-10663853 AGAGCGGGGCTGGCAGAGGCGGG - Intronic
901694533 1:10996993-10997015 ACACCTTGGAAGGCCGAGGCAGG + Intergenic
901929147 1:12585800-12585822 AGGACTGGGCGGGCGGAGGCGGG + Intronic
902288609 1:15422477-15422499 ATACCTGGGGCGGCGGAGGTGGG - Intronic
902588057 1:17453616-17453638 AAACCTGGGAAGGCCAAGGCAGG + Intergenic
902631191 1:17705607-17705629 GGTCCTGGGAGGGCTGAGGCTGG + Intergenic
902699537 1:18162292-18162314 AGACTTGGGGAGGCAGAGGCAGG - Intronic
902705198 1:18199668-18199690 AGACCAGGGAAGGGGGAGGGGGG - Intronic
903028581 1:20446803-20446825 AGAGCTGGGATGGGGGCGGGGGG + Intergenic
903293413 1:22328997-22329019 AGGCCAGGGCTGGGGGAGGCCGG - Intergenic
903738228 1:25543757-25543779 AGAGCTGGGGGGGCGGTGGCCGG + Exonic
904078466 1:27857237-27857259 GGACATGGGATGGGGGTGGCTGG + Intergenic
904946913 1:34206135-34206157 AGGTGTGGGATGGTGGAGGCTGG + Intronic
905146888 1:35893865-35893887 AGAGCTGGGAGGGATGAGGCTGG - Intronic
905294119 1:36943287-36943309 GGACCTGGGATGGGGGAGGGAGG - Intronic
905573228 1:39022835-39022857 CTACCTGGGAAGGCTGAGGCAGG + Intergenic
905913425 1:41669281-41669303 AGACCTGGGGAGGGGAAGGCAGG + Intronic
905934966 1:41816115-41816137 AGACTTGGGATTGTGGAGTCAGG - Intronic
906201569 1:43963841-43963863 AAAGCTGGGATGGCGGTGGGGGG - Intronic
906662544 1:47593273-47593295 AGCCCCGGGCTGGCGGCGGCGGG - Intergenic
906723612 1:48027446-48027468 AATCCTGGGATGGGGGAGGTGGG + Intergenic
907052299 1:51337749-51337771 AGAACTGGGAGGATGGAGGCAGG - Intronic
907102285 1:51847784-51847806 GTTCCTGGGATGGCGGAGGCTGG - Intronic
907486532 1:54781776-54781798 AGACCTGGGGTCGGGGACGCGGG + Exonic
908131434 1:61079722-61079744 AGAGCAGGGATGGAGGAGGAGGG - Intronic
908527389 1:65001323-65001345 AGGCCTCTGCTGGCGGAGGCTGG - Intergenic
909318604 1:74253765-74253787 CTTCCTGGGATGGCCGAGGCTGG - Intronic
910064345 1:83135246-83135268 AGTCCTGGGGAGGCTGAGGCAGG + Intergenic
911632655 1:100200193-100200215 CGACCTGGGATGCTGGAGGTTGG + Intronic
911692043 1:100845494-100845516 CGACCTGGGATGTTGGAGGTTGG - Intergenic
913494679 1:119417572-119417594 GGCCCTGGAATGGTGGAGGCAGG - Intronic
913500590 1:119469312-119469334 GGCCCTGGAATGGGGGAGGCAGG - Intergenic
913518021 1:119621912-119621934 ACACCTGGGATGGGCGAGGGCGG + Exonic
914354016 1:146866349-146866371 AGAGCTGGGATGAGGGAGGAGGG - Intergenic
914417884 1:147501213-147501235 AAACATGGAATGGCAGAGGCTGG + Intergenic
914871503 1:151478827-151478849 AGACCTGGGATGGGGGGGCGGGG - Intergenic
915213760 1:154327337-154327359 GGACATGGGAAGGCGGAAGCAGG + Intronic
915488189 1:156236414-156236436 CGTCCTGGCAGGGCGGAGGCAGG + Exonic
915916070 1:159941752-159941774 AGGCCTGGGCAGGCGGAGGCAGG + Intronic
916148818 1:161766303-161766325 ATATCTGGGACGGCGGCGGCAGG - Exonic
917706593 1:177640935-177640957 TGACCTGGGATGCCTGGGGCTGG + Intergenic
918764274 1:188458515-188458537 AGTCCTGGGAAAGAGGAGGCAGG - Intergenic
918789918 1:188813030-188813052 CTTCCTGGGATGGCCGAGGCTGG + Intergenic
919861359 1:201740993-201741015 AGACCTGGGAAGTTGGAGGTTGG + Intronic
920442390 1:205989656-205989678 AGGGCTGGGGTGGCGGAGGCTGG - Intronic
921228740 1:213047211-213047233 ACACTTGGGGAGGCGGAGGCGGG - Intergenic
922778025 1:228226345-228226367 GGACCTGGGATGGGAGAAGCTGG + Intronic
923437558 1:233982169-233982191 AGACTTTGGAAGGCCGAGGCGGG - Intronic
924548667 1:245053901-245053923 GGACCTAGGATGGGGGTGGCTGG + Intronic
1062840585 10:667105-667127 ACACCTTGGAAGGCCGAGGCAGG + Intronic
1064391109 10:14942876-14942898 AGCCCTTGGGTGGCCGAGGCGGG + Intronic
1064428295 10:15249340-15249362 AGGCCTGGGATTGCCAAGGCAGG - Intronic
1065234133 10:23630305-23630327 ACATCTGGGATGGCAGAGGAAGG + Intergenic
1065727163 10:28677515-28677537 AGACCTGGGCTGGCGCGGGCGGG + Exonic
1065812320 10:29453518-29453540 AGTCCTGTGATGGCTGAGGACGG + Intergenic
1068252545 10:54462624-54462646 AGACTGGGGAAGGCTGAGGCAGG - Intronic
1070159864 10:73859836-73859858 AGACCTGGGAAGCCAGGGGCTGG + Intronic
1070505792 10:77111597-77111619 AGGCCTGGGATGGCAGTGGTTGG - Intronic
1070712644 10:78693914-78693936 AGCCCTGGGATGGGGGAGTCAGG + Intergenic
1071992235 10:91110940-91110962 AAACATGGAATGCCGGAGGCTGG - Intergenic
1072190539 10:93073635-93073657 ACACCTTGGATGGGGGAGGCGGG + Intronic
1072690621 10:97570499-97570521 AGTCCTGGGGTGGTGGGGGCTGG - Exonic
1073062018 10:100738902-100738924 GGACCTTGGAGGGCAGAGGCTGG + Intronic
1073649170 10:105340657-105340679 AGGGCTGGGAGGGAGGAGGCTGG + Intergenic
1074400301 10:113136032-113136054 AGAAGTGGGGTGGTGGAGGCAGG + Intronic
1074544767 10:114393978-114394000 AGACTTGGGATGGCGGTGGGAGG + Intronic
1075051537 10:119186037-119186059 ACACCTGGGGAGGCCGAGGCAGG - Intergenic
1075427242 10:122351322-122351344 AGACTGGGGATGGGGGAGGGAGG + Intergenic
1075492129 10:122880154-122880176 GGACCGGGGTGGGCGGAGGCGGG + Intergenic
1075521381 10:123145702-123145724 TGACTCGGGATGGCGGGGGCGGG - Intergenic
1075598937 10:123753098-123753120 AGACCTGAAAGGGAGGAGGCAGG + Intronic
1076057235 10:127385818-127385840 AGGCCTGTGATGACGGAGGAAGG - Intronic
1077103624 11:832800-832822 CGACCTGGCACTGCGGAGGCCGG - Intergenic
1077356836 11:2122652-2122674 AGGCCTGGGCTGGCTGGGGCTGG + Intergenic
1077607980 11:3625107-3625129 AGACTTGGGGAGGCTGAGGCAGG + Intergenic
1077609947 11:3637875-3637897 AGACCGGGGAGGCGGGAGGCCGG + Intergenic
1079093152 11:17494585-17494607 ACACCTGGGATGGGGGAAGGAGG + Intronic
1079136069 11:17776651-17776673 GGCCCTGGGCTGGGGGAGGCAGG + Intronic
1081487377 11:43542066-43542088 GAACTTTGGATGGCGGAGGCAGG + Intergenic
1081806790 11:45895248-45895270 ACATCTGGGAGGGCAGAGGCAGG + Intronic
1081870653 11:46381342-46381364 CGACCTGGGATGGGGGCAGCGGG + Intronic
1083230699 11:61316673-61316695 ACACTTGGGAAGGCAGAGGCAGG + Intronic
1083733168 11:64664364-64664386 AGAACTTGGAAGGCTGAGGCAGG + Intronic
1084131995 11:67143251-67143273 ACACCTTGGGAGGCGGAGGCGGG - Intronic
1084162310 11:67356508-67356530 AGAGCTGGGAAGCTGGAGGCAGG + Intronic
1084178887 11:67437013-67437035 AGGCCTGGGATGGGGGATGGAGG + Intronic
1084240744 11:67818034-67818056 CTTCCTGGGATGGCCGAGGCTGG - Intergenic
1084270789 11:68028071-68028093 AGACCCAGGAGGGAGGAGGCAGG - Exonic
1084394970 11:68903697-68903719 AGACCTGGGATATGGGAGGAAGG - Intronic
1084542534 11:69796598-69796620 GGGGCTGGGATGACGGAGGCAGG - Intergenic
1084672690 11:70616518-70616540 AGTCCAGGGATGAGGGAGGCAGG + Intronic
1084747378 11:71181826-71181848 AGATCTGGGTTGGCGGGGGAGGG - Intronic
1084831695 11:71774678-71774700 ATTCCTGGGATGGCCGAGGCTGG + Intergenic
1085109746 11:73876993-73877015 AGAGGTGGGCTGGTGGAGGCGGG + Exonic
1086143280 11:83522343-83522365 AGTCTTGGGATGGCAGAGGTGGG + Intronic
1087559286 11:99764525-99764547 CTACTTGGGAAGGCGGAGGCAGG - Intronic
1087896362 11:103590740-103590762 AGAACTGTGATGGCAGAGCCAGG - Intergenic
1087968892 11:104454622-104454644 AGGCCTGGGGTGGGGGAGGGAGG - Intergenic
1088194445 11:107259539-107259561 AGAAGTGGGATGCCTGAGGCTGG + Intergenic
1088317233 11:108519837-108519859 CTACCTGGGAGGGCTGAGGCAGG + Intronic
1088478111 11:110265336-110265358 AGACTTTGGAAGGCCGAGGCAGG - Intronic
1089285476 11:117405009-117405031 AGACCTGGGATGCCCGAGCTTGG - Intronic
1089311866 11:117563415-117563437 AGAACTGGGATGGAGAAGTCAGG + Intronic
1089742382 11:120593495-120593517 AGACCTGAGATGGGGGAAGCAGG - Intronic
1089750717 11:120649208-120649230 ACACCTGGGAGGGCTGAGGGGGG + Intronic
1090202442 11:124866100-124866122 TGACCTGGCTTGGCCGAGGCCGG - Intronic
1090275234 11:125414155-125414177 AGACTTGGGAAGGCAGAGGAAGG + Intronic
1090955774 11:131511912-131511934 ACACCTGGGATGGCAGGTGCAGG + Intronic
1091300452 11:134503929-134503951 AGACCTGGGGAGGAGGAGGCTGG + Intergenic
1091405013 12:203704-203726 GGACCCGGGATGGCCGAGCCGGG + Intronic
1091877736 12:3950459-3950481 AGAGCTGGGATGGTGGAGGGAGG - Intergenic
1092101740 12:5889265-5889287 CTACCTGGGCTGGCCGAGGCCGG - Intronic
1092231383 12:6777576-6777598 AGCGCTGGGATGGGGGTGGCAGG - Intronic
1092295795 12:7199167-7199189 AGAACGTGGATGGAGGAGGCTGG - Intronic
1092733311 12:11555349-11555371 AGACCTGGGAAGGCTGAGGAGGG - Intergenic
1092825918 12:12398737-12398759 ATATCTGGGAAGGGGGAGGCAGG - Intronic
1093715461 12:22376847-22376869 CTTCCTGGGATGGCCGAGGCCGG + Intronic
1094527277 12:31239989-31240011 AGGCTTGGGGTGGCTGAGGCTGG - Intergenic
1095622039 12:44268388-44268410 AGACCTGGAGAGGCCGAGGCGGG - Intronic
1096803157 12:54124936-54124958 AGTTCTGAGATGGAGGAGGCAGG + Intergenic
1097863717 12:64542874-64542896 CTTCCTGGGATGGCCGAGGCCGG + Intergenic
1098061536 12:66568474-66568496 AGACCTGACAAGGAGGAGGCAGG - Intronic
1098370380 12:69753459-69753481 AGATCTCGGAAGGCTGAGGCAGG - Intronic
1098500107 12:71182172-71182194 AGACTTAGGATGGGGGAGGGTGG + Intronic
1099222946 12:79935349-79935371 AGACCTGGAAAGGAGGAAGCGGG + Intronic
1100142286 12:91633887-91633909 CTTCCTGGGATGGCCGAGGCAGG + Intergenic
1101081125 12:101185822-101185844 ACACTTGGGAAGGCTGAGGCAGG - Intronic
1101603797 12:106232975-106232997 CTTCCTGGGATGGCCGAGGCCGG + Intergenic
1101719846 12:107341850-107341872 AGACCAGGGAGGGAGGAGGGAGG - Intronic
1101756885 12:107628052-107628074 ACACCTGGAAAGGTGGAGGCAGG - Intronic
1102027000 12:109719347-109719369 AGAGATGGGAAGGCAGAGGCGGG + Intronic
1102246939 12:111362024-111362046 TGGCCTGGGCTGGCTGAGGCAGG - Exonic
1104834824 12:131782278-131782300 AGAGCTTGGATGGAGGAGGCAGG - Intronic
1105038903 12:132946667-132946689 AGCCCTGGGATGCTGGAGGCAGG - Intronic
1105605205 13:21921074-21921096 CTTCCTGGGATGGCCGAGGCTGG - Intergenic
1106056901 13:26246307-26246329 TGACCTTGGGTGGTGGAGGCGGG + Intergenic
1106080519 13:26496832-26496854 AGAGGTGGGAGGGCGGGGGCGGG - Intergenic
1106172224 13:27297900-27297922 GGACCTGGGAGGTGGGAGGCAGG - Intergenic
1106383393 13:29262092-29262114 AGTCCTGGGCTGGCTGATGCTGG + Intronic
1106413897 13:29529908-29529930 AGACCTGAGATGGCACAGGGTGG + Intronic
1106572577 13:30940577-30940599 ACACTTGGGAAGGCCGAGGCGGG - Intronic
1109610071 13:64753293-64753315 AGAACTGGCATGGAGCAGGCTGG - Intergenic
1111123104 13:83879700-83879722 AGCACTGGGTTGGCGGAGACCGG - Exonic
1111391086 13:87595979-87596001 AGACTTTGGAAGGCCGAGGCGGG + Intergenic
1112196998 13:97235997-97236019 TGACCTGCCCTGGCGGAGGCTGG + Intronic
1113356895 13:109589630-109589652 AGCCCAGGGAGGGAGGAGGCAGG + Intergenic
1113372011 13:109733072-109733094 CCTCCTGGGATGGCTGAGGCAGG - Intergenic
1113576138 13:111396504-111396526 AGCCCTGTGGGGGCGGAGGCGGG + Intergenic
1113850245 13:113413698-113413720 AGAGCTGCGCTGGCGGAGTCTGG + Intergenic
1114271216 14:21101458-21101480 AGACCTGGGATGGGGTAGCCTGG - Intronic
1116498110 14:45587094-45587116 AGAACTGGGTTGCCAGAGGCAGG + Intergenic
1117397770 14:55328034-55328056 AGAACTTGGGAGGCGGAGGCAGG - Intronic
1117536270 14:56705881-56705903 AGTCCAGGGATGGCAGATGCAGG - Intronic
1119628514 14:76205214-76205236 ACACCTGGGGAGGCTGAGGCAGG - Exonic
1121064005 14:90944367-90944389 AGACTTTGGAAGGCTGAGGCAGG + Intronic
1121335950 14:93077612-93077634 AAATGTGGGATGGGGGAGGCTGG - Intronic
1121925883 14:97926960-97926982 AGGCCTTGGATGGGGGAGGCAGG + Intronic
1122073398 14:99219954-99219976 ACACCTAGGCTGGCTGAGGCTGG + Intronic
1122823857 14:104360228-104360250 AGAGCTGGGAGGACGGAGCCTGG + Intergenic
1123813769 15:23955544-23955566 AGCACTTGGAAGGCGGAGGCGGG + Intergenic
1124159441 15:27255199-27255221 AAACCTGGGGTGGCGGGAGCAGG + Intronic
1125485054 15:40105842-40105864 ACACCTTGGCTGGGGGAGGCTGG + Exonic
1125711515 15:41790861-41790883 AGACCTGGGAATGGGGAGGAAGG - Intronic
1127497033 15:59523135-59523157 ACACCTGGGAAGAGGGAGGCGGG + Exonic
1128141113 15:65301490-65301512 CTTCCTGGGATGGCCGAGGCCGG - Intergenic
1128227651 15:66013358-66013380 AGACCTGGGGTGGGGGTGGGAGG - Intronic
1129082357 15:73052312-73052334 AGACCGCGGACGGCGGGGGCGGG - Intronic
1129191379 15:73939588-73939610 CTGCCTGGGGTGGCGGAGGCGGG + Intronic
1129342936 15:74897848-74897870 AGAGCTGGGGTGGGGGAGGAGGG + Exonic
1130094467 15:80845727-80845749 TGACCTGGGATGGAGTGGGCAGG + Intronic
1132403349 15:101527411-101527433 ACACCTTGGGTGGCTGAGGCAGG - Intergenic
1132512534 16:351658-351680 ACACCTTGGAAGGCTGAGGCAGG + Intronic
1132864626 16:2087321-2087343 AGAGCTGGCATGGCCCAGGCAGG + Intronic
1132895667 16:2228326-2228348 GGGCCTGGGAAGGCGGAGGCTGG - Intronic
1133138345 16:3727918-3727940 AGACGTGGTGTGGCGAAGGCTGG + Exonic
1134171896 16:11976025-11976047 GCACTTGGGAGGGCGGAGGCAGG - Intronic
1134622642 16:15700987-15701009 AGACTTTGGAAGGCCGAGGCGGG + Intronic
1134890029 16:17832660-17832682 AGACTTGGGATGGAGGAGGGAGG + Intergenic
1135583825 16:23651786-23651808 AGACCAAGGCAGGCGGAGGCGGG + Intronic
1136564272 16:31060907-31060929 AGAGCTGGGACAGTGGAGGCTGG - Exonic
1137707220 16:50544002-50544024 AGATATGAGATGGAGGAGGCTGG - Intergenic
1137959476 16:52867582-52867604 AGACCTGGAAGGGCGGAGGGTGG - Intergenic
1138168784 16:54829761-54829783 CTTCCTGGGATGGCCGAGGCCGG + Intergenic
1138228934 16:55324011-55324033 AGTCCTGGGGAGGCTGAGGCGGG + Exonic
1138413526 16:56858227-56858249 AGGCCTGGGAAGCCAGAGGCTGG - Intergenic
1139980003 16:70849173-70849195 AGAGCTGGGATGAGGGAGGAGGG + Intronic
1141126948 16:81407697-81407719 AGACCTGGCAGGGTGGGGGCAGG - Intergenic
1141691237 16:85597797-85597819 AGACCAGTAATGGCTGAGGCTGG - Intergenic
1142131938 16:88435120-88435142 AGCCCTGGGCAGGCGGTGGCTGG - Exonic
1142359808 16:89620694-89620716 TGACCTGGGAGGCAGGAGGCGGG + Exonic
1142875481 17:2849650-2849672 AGACCTGGGCTGGCAGCTGCCGG + Intronic
1144500865 17:15786264-15786286 AGACCTGGGACCGCGGGGGGCGG - Intergenic
1145163026 17:20588926-20588948 AGACCTGGGACCGCGGGGGGCGG - Intergenic
1145359711 17:22202240-22202262 AGTCCTGGGGAGGCTGAGGCAGG - Intergenic
1145845276 17:28033088-28033110 AGACTTTGGAAGGCTGAGGCAGG + Intergenic
1145907951 17:28526529-28526551 ACACATGGGAAGGCGGAGTCTGG + Intronic
1146655301 17:34631425-34631447 GGAGCTGGGATGGGGGAGTCTGG - Intronic
1147305469 17:39561141-39561163 AGACCTGGAATGGGGAAGGGAGG + Intronic
1147906509 17:43826670-43826692 AGACCTGGGATGGTGGGGAAGGG + Intronic
1148461348 17:47840764-47840786 ACAGCCGGGATGGCTGAGGCCGG + Exonic
1148903765 17:50898525-50898547 ACACCTGGGAAGGCCAAGGCAGG + Intergenic
1149569513 17:57662630-57662652 AGCCCTGGGATGGCTGAGCCAGG + Intronic
1149591749 17:57835122-57835144 AGATCTGGGATGTTGGGGGCTGG - Exonic
1150257026 17:63755211-63755233 ACACTTTGGGTGGCGGAGGCAGG - Intronic
1150788210 17:68179791-68179813 CTTCCTGGGATGGCTGAGGCCGG + Intergenic
1151223609 17:72632113-72632135 AGACCAGGGATGAGGGAGACTGG + Intergenic
1151438557 17:74113726-74113748 CTTCCTGGGATGGTGGAGGCTGG - Intergenic
1151448082 17:74180444-74180466 AGACCTGGGCTGGGGCAGGATGG + Intergenic
1151539293 17:74757060-74757082 AAGCCTGGGATGGAGCAGGCTGG - Intronic
1151620300 17:75240917-75240939 AGGCCTGGGGTGGTGGAGGGAGG + Exonic
1151824076 17:76513918-76513940 AGACTTTGGGTGGCTGAGGCAGG - Intergenic
1151835778 17:76581722-76581744 ACACCTGGGAGGGCGTAGGAAGG + Intronic
1152386524 17:79978058-79978080 AGGCCTGGGATGGCAGAATCCGG - Intronic
1152620701 17:81363367-81363389 AGACATGGAAAGGAGGAGGCTGG - Intergenic
1152736472 17:81999817-81999839 ACACCTGGGAGGGCAGAGGCCGG + Intronic
1152811853 17:82386117-82386139 AGGCCGGGGAAGGCGGAGGCAGG - Intergenic
1153713275 18:7820942-7820964 TGACCAGGGCTGGGGGAGGCAGG - Intronic
1157479228 18:48042523-48042545 TGTCCTGGGAAGGCAGAGGCAGG + Intronic
1157482812 18:48066345-48066367 AGCCCTGGGGGGGCGGAGGTGGG + Intronic
1158266378 18:55664833-55664855 CTTCCTGGGATGGCCGAGGCGGG + Intergenic
1158319641 18:56248874-56248896 AGACCTGGGGTGGGGGTGGAGGG + Intergenic
1158591979 18:58785504-58785526 AGAGCTGGGAGAGAGGAGGCGGG - Intergenic
1159455985 18:68660731-68660753 AGACCTGGGCTGGGAGACGCGGG + Intergenic
1160131962 18:76233296-76233318 AGAGCTGGGATGTAGGAGGAAGG + Intergenic
1160203033 18:76810777-76810799 AGACGTGGCCTGGCGGAGGGTGG - Intronic
1160508949 18:79442629-79442651 AGACGTGCGGTGGCGGCGGCGGG + Intronic
1160550395 18:79691333-79691355 AGACCTGTGCTGGGGAAGGCAGG + Intronic
1160989209 19:1853769-1853791 AGACCTGGGATGGGGAGGGAGGG - Exonic
1161027794 19:2044641-2044663 AGACATGGGACTGCAGAGGCAGG - Intronic
1161286726 19:3472203-3472225 GGAACTGGGATGGGGGAGGTTGG - Intergenic
1162495450 19:11020952-11020974 AGTCCTCGGAAGGCTGAGGCAGG - Intronic
1162578790 19:11515083-11515105 AGACTTGGGGAGGCTGAGGCAGG - Intronic
1163769242 19:19180682-19180704 TGACCTGGGTTGGCGGAGGCTGG + Exonic
1163866939 19:19781402-19781424 ACACCTTGGGAGGCGGAGGCAGG + Intergenic
1164732838 19:30519200-30519222 AGAGCTGGGCTGGGGGAGGCAGG - Intronic
1165094598 19:33403275-33403297 TGACCCTGGCTGGCGGAGGCTGG + Intronic
1166230178 19:41421991-41422013 AGACCTGGGTGGGCAGATGCTGG + Intronic
1166365517 19:42276418-42276440 AGACCAGGGAGGAAGGAGGCTGG + Intronic
1166794320 19:45417251-45417273 AGCCCTGGGAGGGCAGAGTCAGG - Intronic
1166921424 19:46231473-46231495 AGCCATGGGGTGGTGGAGGCTGG - Intergenic
1167011991 19:46814600-46814622 AGACTTTGGGTGGCTGAGGCAGG - Intergenic
1167337510 19:48896062-48896084 AAACCCGGGATTGCGGAGACGGG - Intronic
1167348875 19:48962986-48963008 AGACCTGGGGGGGCGGGGACAGG - Intergenic
1167487548 19:49771901-49771923 AGAGCTGTGAAGGCAGAGGCGGG + Intronic
1167649610 19:50722249-50722271 AGGCCAGGGAAGGTGGAGGCTGG + Intergenic
1168645434 19:58056278-58056300 AGCACTGGGATGGTGGAGGCTGG + Intergenic
1168696540 19:58407067-58407089 AGACCTGCGAGGGCACAGGCTGG + Intronic
1168705187 19:58466811-58466833 ACACCTGGAATGCCGAAGGCAGG + Intergenic
925043233 2:750463-750485 GAACCTGGGATGGTGGAGACTGG - Intergenic
925046656 2:777745-777767 TGACGTGGGATGGCCCAGGCAGG - Intergenic
925587185 2:5475517-5475539 AGCGCTGGGAGGGAGGAGGCGGG + Intergenic
926001605 2:9338053-9338075 CGACGTGGGATGGGGAAGGCAGG - Intronic
926368001 2:12151246-12151268 AGACCCAGGATGGCAGAGTCAGG - Intergenic
926700843 2:15802220-15802242 TGAACTGGCATGGCAGAGGCTGG + Intergenic
927192080 2:20523888-20523910 AGGCCTGGAAGGGAGGAGGCTGG - Intergenic
927250893 2:20994045-20994067 AGACCTGTGAGTGGGGAGGCAGG + Intergenic
927543528 2:23932856-23932878 AGACTTGGGGAGGCCGAGGCAGG + Intronic
927740932 2:25569077-25569099 TGCCCTGGGATGGGGAAGGCCGG - Intronic
927741265 2:25571731-25571753 AGTCCTCAGATGGAGGAGGCTGG - Intronic
927812320 2:26187046-26187068 TGACCTGGGCTGGGGGATGCTGG + Intronic
927871410 2:26626789-26626811 AGACCTGGGATGGGGCAGGTGGG - Intronic
927996775 2:27492540-27492562 AGATCTGGGATGGGGGAGGCTGG - Intronic
928106315 2:28472641-28472663 CTTCCTGGGATGGCCGAGGCCGG + Intronic
928409383 2:31042774-31042796 AGGCCTGAGACGGTGGAGGCTGG - Intronic
929541738 2:42828209-42828231 AGACCTGGGCTGGAAGAGCCAGG + Intergenic
929601254 2:43206173-43206195 AGGGCTGGGCTGGAGGAGGCTGG + Intergenic
929931164 2:46256577-46256599 AGCCCTAGGTTGGGGGAGGCAGG - Intergenic
930167998 2:48222243-48222265 AAACCTGGGGAGGCAGAGGCAGG + Intergenic
930642967 2:53873127-53873149 CTACTTGGGATGGCTGAGGCAGG + Intronic
932828482 2:74963734-74963756 GCACCTTGGAAGGCGGAGGCAGG - Intronic
932947085 2:76247396-76247418 AGAAATGGGTTGGCAGAGGCAGG + Intergenic
933765584 2:85706435-85706457 AGGAATGGGATGGCGGATGCTGG + Intergenic
934509069 2:94922466-94922488 AGACTTTGGGTGGCTGAGGCAGG - Intergenic
935778092 2:106489497-106489519 AGACCTGGGTAGGCAGAGGGGGG - Intergenic
937221255 2:120344419-120344441 CGGCCTGGGATGCCAGAGGCAGG - Intergenic
937912540 2:127082454-127082476 AGACCAGGGTTGGCGTGGGCAGG + Intronic
938041739 2:128081838-128081860 AAACATGGGAAGGCTGAGGCAGG + Intergenic
938296128 2:130180879-130180901 AGACCTGTGACGGGGGAGGGTGG - Intronic
938406160 2:131034516-131034538 AATGCAGGGATGGCGGAGGCAGG - Intronic
938460615 2:131493775-131493797 AGACCTGTGACGGGGGAGGGTGG + Intergenic
939015220 2:136895202-136895224 AGCCCTGGGATGCTGCAGGCAGG + Intronic
939534787 2:143414685-143414707 ACACTTTGGATGGCGAAGGCAGG + Intronic
939898853 2:147826804-147826826 CTTCCTGGGATGGCCGAGGCTGG + Intergenic
941047767 2:160695717-160695739 AGAGCTGGGAGCGAGGAGGCTGG - Intergenic
944509018 2:200446090-200446112 ACACCTTGGAAGGCCGAGGCAGG + Intronic
944866733 2:203869988-203870010 ATGCCAGGGAAGGCGGAGGCTGG + Intronic
945043103 2:205758919-205758941 AGAGCTGGTATGGTGGGGGCGGG - Intronic
946013375 2:216584447-216584469 AGAGCTGAGAGGGCGGAGGACGG - Intergenic
946137271 2:217657540-217657562 AGAGCTGGGCTTGCGGAGGATGG - Intronic
946302552 2:218832683-218832705 AGGGCTGGGATGGAAGAGGCTGG - Intergenic
946313998 2:218897647-218897669 AGACCCGGCCTGGCGGAGGACGG - Intronic
946710170 2:222497362-222497384 AGACCCGGGGAGGCAGAGGCAGG - Intronic
948138328 2:235653808-235653830 ACACTTTGGATGGCCGAGGCAGG + Intronic
948541023 2:238691522-238691544 ATGCCTGGGATGGAGGAGGGAGG - Intergenic
948806574 2:240455789-240455811 GGACATGAGATGGCAGAGGCCGG - Intronic
948866469 2:240777552-240777574 AGGCTTGGGATGGTGGAGGCTGG - Intronic
948874923 2:240821060-240821082 AGCCCTGGGACGGTGGAGGGAGG - Intergenic
948902262 2:240962767-240962789 AGACCTGGGAGGCAGGAGACTGG + Intronic
1168895332 20:1319987-1320009 AGTGCTGGGATGGAGGAGGAAGG + Intronic
1169676464 20:8159874-8159896 CTACCTGGGAAGGCTGAGGCAGG + Intronic
1170232119 20:14060590-14060612 AGACCTGGGATGGAGGATGGGGG + Intronic
1170359808 20:15533763-15533785 GGTCCTGGGATGGAGGAGGGAGG + Intronic
1171128785 20:22628797-22628819 AGATTTGTGATGGAGGAGGCGGG + Intergenic
1171973489 20:31578978-31579000 CTTCCTGGGATGGCCGAGGCCGG - Intergenic
1172133962 20:32674893-32674915 AGAACTGGGAGGCCCGAGGCAGG - Intergenic
1172177299 20:32980209-32980231 AGACCAGGCATGGCTGGGGCAGG - Intergenic
1172380765 20:34488789-34488811 GCACTTTGGATGGCGGAGGCAGG + Intronic
1172661048 20:36569001-36569023 ACACTTGGGACGGCTGAGGCAGG + Intergenic
1172665096 20:36593599-36593621 AGGGCTGGGATGGAAGAGGCTGG - Exonic
1172779121 20:37425259-37425281 AGGCCAGGGGTGGCGGAGGGTGG + Intergenic
1172801644 20:37580383-37580405 TGAGGTGGGATGGAGGAGGCTGG - Intergenic
1173455925 20:43201176-43201198 AGGACTGGGATGGAGGAGGGGGG + Intergenic
1174048028 20:47747752-47747774 AGAGATGGGAAGGCGGGGGCAGG - Intronic
1174565125 20:51458970-51458992 AGAGCAGGGATGGCAGATGCAGG - Intronic
1175538076 20:59729226-59729248 AGACCTGGGCCGGGGGAGTCAGG + Intronic
1175818581 20:61896381-61896403 AGGCCTGGGATGCAGGACGCAGG - Intronic
1177653664 21:23988447-23988469 AGTCCTTGGAAGGCTGAGGCAGG - Intergenic
1179057111 21:37946416-37946438 AGACCAGGGATGGTGGTGGGGGG - Intergenic
1179553180 21:42156235-42156257 AGACCAGGGTGGGCGGAGGAGGG + Intergenic
1179648301 21:42789510-42789532 AGACATGGGAGGGAGGAGCCAGG + Intergenic
1179813052 21:43884545-43884567 AGGCCTGGGGTGGGTGAGGCTGG + Intronic
1180036266 21:45251956-45251978 GGGCCTGGGAGGGCAGAGGCAGG + Intergenic
1180063976 21:45403981-45404003 GGGCCTGGGAAGGCTGAGGCAGG + Intergenic
1180864049 22:19105720-19105742 AGACCTGGGAGGGCAGAGCTAGG + Intronic
1181038581 22:20181531-20181553 ACACCTGCCATGGGGGAGGCTGG + Intergenic
1181317152 22:21978219-21978241 AGACCTGGGATGGCGGGACATGG + Intronic
1182296650 22:29314186-29314208 AGACCAAGGATGAAGGAGGCTGG - Intronic
1183075785 22:35426036-35426058 AGTCCTGGCCTGGGGGAGGCAGG + Intergenic
1183474359 22:38027695-38027717 AGGCCTGGGGTGGCGGAGGCGGG - Intronic
1183560731 22:38570440-38570462 CGAGCTGGGATGACGGAGGGAGG + Intergenic
1183586226 22:38754819-38754841 AGTTCTGGGAGGGCGGAGGCGGG - Intronic
1183703785 22:39464549-39464571 CTACCTGGGAAGGCTGAGGCAGG - Intronic
1183894504 22:40957397-40957419 AGACTTTGGGTGGCTGAGGCGGG + Intronic
1184151531 22:42642358-42642380 AGAACTTGGAAGGCTGAGGCTGG - Intronic
1184181352 22:42828929-42828951 ACACTTTGGATGGCTGAGGCGGG - Intronic
1184194213 22:42916017-42916039 AGGCCTGGGATGGTGGAAGGCGG + Intronic
1184247609 22:43243582-43243604 AGACCTGGGGCGGCGTAAGCAGG - Intronic
1184288789 22:43487185-43487207 ACACCTGTGCTGGGGGAGGCAGG + Intronic
1184453058 22:44594317-44594339 AGACTGGGGATGGCGGGGGTCGG - Intergenic
1184569135 22:45310816-45310838 AGACCTGAGGTGGCCGAGGGCGG + Intronic
1184569262 22:45311490-45311512 AGACCTGGTATGGGAGAAGCTGG + Intronic
1184737576 22:46408579-46408601 ACACTTTGGGTGGCGGAGGCCGG - Intronic
1184846357 22:47090234-47090256 AGACATGAGCTGGCGGATGCTGG - Intronic
1185348922 22:50324050-50324072 AGAGCTGAGAAGGCGGAGCCAGG + Intronic
949105575 3:197389-197411 AGGGATGGGGTGGCGGAGGCTGG - Intronic
950088152 3:10276002-10276024 CGACCTGGGGTGGCAGGGGCAGG - Intronic
950096104 3:10331593-10331615 AGACTTGAGATGGCCGTGGCGGG - Intronic
950121051 3:10482812-10482834 AGGCCTGGGATGGCAGACGGAGG - Intronic
950320629 3:12049405-12049427 CCACCTGGGAGGGCTGAGGCAGG + Intronic
950401068 3:12769277-12769299 CTTCCTGGGATGGCCGAGGCCGG - Intronic
950506043 3:13395166-13395188 TGGCCTGGGAAGGCTGAGGCAGG + Intronic
953249948 3:41236061-41236083 TGACCTGGGCTGCCAGAGGCAGG + Intronic
954200385 3:49020484-49020506 AGACGTGGGAGAGCCGAGGCTGG - Intronic
954803303 3:53200075-53200097 ACAACTGGGATGGGGCAGGCAGG - Intergenic
958814658 3:98901910-98901932 GGACCTGGATTGGAGGAGGCGGG - Intergenic
960101451 3:113746954-113746976 AGCGCTGGGATGGAGGAGGCAGG + Intergenic
961298176 3:125903876-125903898 CTTCCTGGGATGGCCGAGGCTGG + Intergenic
962243107 3:133767888-133767910 AGTCCTGGGTTGGTGGTGGCTGG + Intronic
963605463 3:147409183-147409205 ATACCTGGGATTGATGAGGCGGG + Intronic
964751803 3:160060467-160060489 CTTCCTGGGATGGCCGAGGCTGG + Intergenic
964862865 3:161221427-161221449 AGACCTGGGCTGTCGGCCGCGGG + Intronic
965598697 3:170433550-170433572 GGACATGGGATGGGGGAGGGAGG + Exonic
966559978 3:181309318-181309340 AGACCTAGGATGTCAGAGTCTGG + Intergenic
966751970 3:183330971-183330993 AGCCCTGGGGTGGGGGTGGCGGG - Intronic
968133068 3:196203516-196203538 AGCCCAGGGATGGAGGAGGAAGG + Intronic
968923461 4:3534527-3534549 ATACCTGGGCTGGGGGAGGAGGG + Intergenic
968924689 4:3541036-3541058 ATACCTGGGAGGGGGGAGGGAGG - Intergenic
969174790 4:5390288-5390310 ATAACTGGGATGGCTGTGGCTGG - Intronic
969327715 4:6453395-6453417 AGAGCTGGGGTGGCTGGGGCTGG - Intronic
969519046 4:7665198-7665220 AGACATGGAAAGGAGGAGGCTGG - Intronic
969636182 4:8370569-8370591 AGACCTGGGACCGGGGAGGCCGG + Intronic
970456301 4:16226816-16226838 GGGCCGGGGATGGCGGCGGCGGG + Intronic
971330584 4:25678075-25678097 AGAATTGGGATGGCTGAGGGTGG - Exonic
972505833 4:39718919-39718941 CTTCCTGGGATGGCCGAGGCCGG - Intronic
972512590 4:39783726-39783748 ACACCTGGGGGGGCAGAGGCAGG + Intergenic
976611491 4:87035226-87035248 TTACCTGGGAGGGCTGAGGCTGG + Intronic
977206465 4:94169784-94169806 CTTCCTGGGATGGCGGAGGCCGG + Intergenic
977810221 4:101348115-101348137 AGCCCTGAGAGGGCGGAGGAAGG + Intronic
978207242 4:106092808-106092830 CTTCCTGGGATGGCCGAGGCTGG - Intronic
980429611 4:132676570-132676592 AGACCTTGGGAGGCCGAGGCAGG + Intergenic
980785813 4:137553330-137553352 ACACCTTGGAAGGAGGAGGCAGG + Intergenic
980935927 4:139225840-139225862 ACACCTTGGAAGGCTGAGGCAGG + Intergenic
981762522 4:148209773-148209795 AGACCTGGAAGGGCAGAGGAAGG - Intronic
983537970 4:168878155-168878177 AGACCGGGGGTGGCGGGGGCGGG - Intronic
983656684 4:170091174-170091196 CTTCCTGGGATAGCGGAGGCCGG + Intronic
985047565 4:185955846-185955868 AGACCTGGGGTGGGGGTGGAGGG - Intronic
985664593 5:1175449-1175471 GGTCCTGGGATGGAGGAGGCTGG + Intergenic
985828202 5:2208188-2208210 AGACCTGGGATGCTGCCGGCCGG - Intergenic
987049368 5:14136545-14136567 AGACCTGGCAGGGTGGTGGCAGG + Intergenic
987051135 5:14146963-14146985 AGACCTGGCATGAAGCAGGCAGG + Intronic
987444991 5:18006406-18006428 TGACCTGGGATGCAGGAGCCTGG + Intergenic
988218824 5:28315148-28315170 GGACCTGGAATGGAGGATGCGGG - Intergenic
989953211 5:50325939-50325961 AGACTTGGAAGGGCGGAGGGTGG - Intergenic
989963428 5:50441435-50441457 AGAGCCGAGAGGGCGGAGGCCGG - Intronic
990175555 5:53103952-53103974 AGAACTGGGCAGGCTGAGGCTGG + Intronic
991693323 5:69246379-69246401 GGACTTTGGAAGGCGGAGGCGGG - Intronic
991733784 5:69613456-69613478 AGACCTGGGTGGGGTGAGGCAGG - Intergenic
991810218 5:70468598-70468620 AGACCTGGGTGGGGTGAGGCAGG - Intergenic
991860483 5:71008690-71008712 AGACCTGGGTGGGGTGAGGCAGG + Intronic
991987030 5:72299330-72299352 AGACCTGGGATGGGGAGGGGCGG + Intronic
992508637 5:77412069-77412091 ACAGATGGGATGGGGGAGGCTGG - Intronic
995475907 5:112548018-112548040 AGGCCAGGGTTGGCGGGGGCAGG - Intergenic
996423784 5:123290866-123290888 AGCCATGGGATTGCGGAGACTGG - Intergenic
997211221 5:132078036-132078058 TGACCAGGGATGGATGAGGCTGG + Intergenic
998977364 5:147662872-147662894 ATACTTGGGAAGGCTGAGGCAGG + Intronic
998999793 5:147907872-147907894 ACACTTGGGAAGGCTGAGGCGGG - Intergenic
999257500 5:150217733-150217755 AGCCCAGGGACGGGGGAGGCTGG + Intronic
1001447102 5:171794126-171794148 GGACCTGGGATTGTGGAGACTGG + Intronic
1001752227 5:174140452-174140474 AGACCTGGAAATGAGGAGGCAGG - Intronic
1001801614 5:174549181-174549203 AGGCCTGGGATGGGGGTGGGTGG - Intergenic
1001843512 5:174901465-174901487 CTTCCTGGGATGGCCGAGGCTGG + Intergenic
1002143487 5:177160135-177160157 GCACTTGGGAAGGCGGAGGCAGG - Intronic
1002784719 6:392401-392423 AGGCCCGGGAGAGCGGAGGCGGG - Intronic
1003477050 6:6492784-6492806 TGACCAGGGTTGGCGGAGGTTGG + Intergenic
1003567068 6:7230724-7230746 AGACATGGGGAGGTGGAGGCTGG - Exonic
1003749527 6:9040708-9040730 TTTCCTGGGATGGCCGAGGCAGG + Intergenic
1004497828 6:16181133-16181155 TACCCTGGGATGGCTGAGGCTGG - Intergenic
1005841650 6:29748056-29748078 GGACCTGCGGTGGCGGGGGCAGG + Intergenic
1006657165 6:35605642-35605664 AGACTTTGGAAGGCCGAGGCAGG - Intronic
1006981720 6:38153134-38153156 AGACCAGAGCCGGCGGAGGCGGG - Exonic
1007406120 6:41637328-41637350 AGAGCTGGGACGCAGGAGGCCGG - Intronic
1007447260 6:41916466-41916488 CTACCTGGGAAGGCTGAGGCAGG + Intronic
1007702683 6:43773793-43773815 AGAGCTTGGATGGGGGAGGGTGG + Intronic
1007820977 6:44560242-44560264 TGAGCTGGGATGGGGGAGGGGGG + Intergenic
1008627266 6:53329575-53329597 AGACTTTGGAAGGCTGAGGCGGG + Intronic
1009440043 6:63667014-63667036 AGTGCTGGGATTGCAGAGGCGGG + Intronic
1011218931 6:85033787-85033809 AGGCCTGTGATGGGAGAGGCTGG + Intergenic
1013390238 6:109679242-109679264 TGACCTGGGATGCTGGAGCCTGG + Intronic
1015750115 6:136550509-136550531 AGTCCGGGGATGGCGGAGGGCGG + Intronic
1016104783 6:140148536-140148558 CTTCCTGGGATGGCCGAGGCCGG - Intergenic
1016937701 6:149459802-149459824 ATACCTGGCATGGAGCAGGCAGG - Intronic
1017048766 6:150371391-150371413 TGACCTAGAATGGAGGAGGCAGG + Intronic
1017190772 6:151650413-151650435 AGAACTGGGGAGGCTGAGGCAGG - Intergenic
1017534214 6:155329150-155329172 AGACCTGGGGTGGGGGCAGCAGG + Intergenic
1019145857 6:169975259-169975281 GGACCTGGGGTGGGGGAGGGAGG + Intergenic
1019390440 7:783749-783771 AGAGCTGGGAGGGCGCAGGCAGG - Intronic
1019929046 7:4211358-4211380 AGACCAGGGAGTGAGGAGGCCGG + Intronic
1021605193 7:22402962-22402984 AGGCCTGGGGTGAAGGAGGCGGG - Intergenic
1021693900 7:23257423-23257445 GCACCTTGGAAGGCGGAGGCGGG + Intronic
1021801529 7:24311591-24311613 AGACCTGGAAGGGAGGAAGCTGG + Intergenic
1021967814 7:25939083-25939105 AGATTTGGGATGGGGGAGGGTGG + Intergenic
1023310984 7:38886417-38886439 TGACCTGGGATGCCGGAGCTTGG + Intronic
1023909102 7:44541246-44541268 AGACCTGGGATGGCGGAGGCCGG - Exonic
1024292237 7:47813064-47813086 AGAGCTGGAGTGGCGGTGGCAGG + Intronic
1024318273 7:48041387-48041409 AGACCTGGGATCTGGGACGCTGG - Exonic
1027421281 7:78019931-78019953 AGACCTGGGGCGGCGGCAGCGGG + Exonic
1028090735 7:86697453-86697475 AGACCTGGTTTGTCGGAGGATGG + Intronic
1028998801 7:97130627-97130649 AGCCCTGTGATGGCAGAGGGTGG + Intronic
1029163912 7:98572561-98572583 AGATCAGGGATGTCAGAGGCAGG - Intergenic
1029271211 7:99377877-99377899 AGACTTTGGGAGGCGGAGGCAGG - Intronic
1029988113 7:104940101-104940123 CTTCCTGGGCTGGCGGAGGCTGG + Intergenic
1030365752 7:108644160-108644182 AGATCTGGGTTGGGGGAGGATGG + Intergenic
1032000649 7:128263019-128263041 ACAGCTGGGATGGCTGGGGCTGG - Intergenic
1033366953 7:140678967-140678989 AGATCTGGGATTGCTGGGGCAGG + Intronic
1033466642 7:141597049-141597071 AGACCTGGGAGGAAGCAGGCAGG + Intronic
1034274930 7:149819858-149819880 AGGCATGGGATTGCAGAGGCGGG - Intergenic
1034560400 7:151876333-151876355 CGAGCTGGGCTGGCGGAGCCGGG - Intronic
1034974821 7:155441934-155441956 AGCCCTGGGAGGGGGGAGGGAGG - Intergenic
1035168627 7:157005900-157005922 AGCCCTGGGGTGGCGGTGGCCGG - Intronic
1035325044 7:158060366-158060388 AGACCTGTGATGGCGGCCGCTGG - Intronic
1035474985 7:159136917-159136939 ATACCTGGGGAGGAGGAGGCAGG + Intronic
1035987930 8:4454965-4454987 GGACCTGGGATGGCAGAGTTAGG + Intronic
1036033360 8:4994643-4994665 AGACCCGGGCTGGCGGGGCCGGG + Exonic
1036188330 8:6645175-6645197 AGGCCTGGGTGGGCAGAGGCTGG - Intergenic
1037592991 8:20329106-20329128 AGGCCTGGGATGGAGGTTGCTGG - Intergenic
1037617631 8:20533913-20533935 AGCCATGGGATGGCAGAGGATGG + Intergenic
1041184790 8:55287708-55287730 AGAACGGGGATGGCGAAGACAGG - Intronic
1041586934 8:59531760-59531782 AGTCCATGGATGGCTGAGGCAGG - Intergenic
1042011997 8:64256940-64256962 TGAACTGGGGTGGCTGAGGCAGG - Intergenic
1042396034 8:68292815-68292837 AGTCCTGGGATGAAGGGGGCAGG + Intergenic
1043383851 8:79730093-79730115 AGACCAGGGATGGGAGAGCCTGG - Intergenic
1044479787 8:92671947-92671969 GGACCTTGGGTGGCGAAGGCGGG + Intergenic
1044758791 8:95494741-95494763 AGGCCTGGGATGGCTGCGGGAGG + Intergenic
1045137051 8:99232808-99232830 AGTCCTGGGAGGTAGGAGGCAGG + Intronic
1047124680 8:121947980-121948002 CCTCCTGGGATGGCCGAGGCTGG + Intergenic
1049014931 8:139913655-139913677 AGCCCTGGGATGGCCGACGCTGG + Intronic
1049099548 8:140569099-140569121 TGACCTGGGATGGGGGTGTCTGG - Intronic
1049376275 8:142290797-142290819 AGGCCCGGGAGGGCGGAGGATGG - Intronic
1049451855 8:142666246-142666268 AGACCAGGGATACCTGAGGCAGG - Exonic
1049502528 8:142974995-142975017 AGAGCTGGGAGCGCGCAGGCCGG + Intergenic
1049584225 8:143425565-143425587 AGCCCTGGGAGAGGGGAGGCTGG - Intronic
1049660530 8:143817838-143817860 TGAGCTGGGGTGGCTGAGGCGGG - Intronic
1049692690 8:143969548-143969570 AGACCTGGGGTGGGTGTGGCAGG + Intronic
1049692943 8:143970749-143970771 AGACCTGGGGTGGGTGTGGCAGG - Intronic
1049820354 8:144629712-144629734 AGACCTGTGCTGGCAGAGGGTGG + Intergenic
1050431423 9:5566041-5566063 AGAACTGGGATGGCAGAGAATGG - Intronic
1052133966 9:24888285-24888307 ATACTTGGGGTGGCTGAGGCAGG + Intergenic
1052832200 9:33225190-33225212 AGACTTTGGAAGGCCGAGGCGGG - Intronic
1053393344 9:37751821-37751843 CTTCCTGGGATGGCCGAGGCCGG + Intronic
1053418889 9:37964339-37964361 AAACCTGGGATGGGGACGGCGGG + Intronic
1053427902 9:38023072-38023094 ACCCCTGCCATGGCGGAGGCAGG + Intronic
1053799171 9:41753551-41753573 ATACCTGGGCTGGGGGAGGAGGG + Intergenic
1053799761 9:41757003-41757025 ATACCTGGGAGGGGGGAGGGAGG - Intergenic
1054145450 9:61557931-61557953 ATACCTGGGAGGGGGGAGGGAGG + Intergenic
1054146041 9:61561448-61561470 ATACCTGGGCTGGGGGAGGAGGG - Intergenic
1054187585 9:61965610-61965632 ATACCTGGGCTGGGGGAGGAGGG + Intergenic
1054188171 9:61969058-61969080 ATACCTGGGAGGGAGGAGGGAGG - Intergenic
1054352731 9:64031857-64031879 AGACTTTGGGTGGCTGAGGCAGG + Intergenic
1054465775 9:65492526-65492548 ATACCTGGGCTGGGGGAGGAGGG - Intergenic
1054650345 9:67619518-67619540 ATACCTGGGAGGGGGGAGGGAGG + Intergenic
1054650932 9:67622971-67622993 ATACCTGGGCTGGGGGAGGAGGG - Intergenic
1054793640 9:69278530-69278552 AGACTTTGGAAGGCCGAGGCGGG - Intergenic
1054898228 9:70338125-70338147 ATACCTGGAAAGGCTGAGGCAGG - Intronic
1055814222 9:80185712-80185734 CTTCCTGGGATGGCCGAGGCGGG - Intergenic
1056072940 9:83007736-83007758 AGGCTTGTGATGTCGGAGGCGGG - Intronic
1056796074 9:89659767-89659789 AGATGTGGGATGGGGGAGGCAGG + Intergenic
1056937405 9:90926809-90926831 AGGATTGGGATGGCGGAGGCAGG + Intergenic
1057118107 9:92545188-92545210 CTTCCTGGGATGGCCGAGGCCGG + Intronic
1057118118 9:92545220-92545242 GGACCTGGGATGGCCGAGGCCGG + Intronic
1057520317 9:95754751-95754773 AGAACTGTGATTGCGGGGGCTGG + Intergenic
1058818152 9:108704493-108704515 AGACCTGGATGGGCGGGGGCAGG - Intergenic
1059328132 9:113517179-113517201 AGATGGGGGATGGCGGGGGCTGG + Intronic
1059337919 9:113580757-113580779 AGAACAGGGTTGGCAGAGGCAGG + Intronic
1060074598 9:120580067-120580089 AGAGCTGGGGTGGAGGGGGCGGG - Exonic
1060351377 9:122863846-122863868 CTACCTGGGAAGGCTGAGGCAGG - Intronic
1060415577 9:123427466-123427488 AGACCAGGGAGGTAGGAGGCAGG - Intronic
1060433505 9:123571459-123571481 TGGGCTGGGATGGAGGAGGCAGG - Intronic
1060670385 9:125463929-125463951 AGATCTGGCATGGCTGAGTCTGG + Intronic
1060979644 9:127785175-127785197 GGACCGGGGGAGGCGGAGGCGGG + Intergenic
1060999881 9:127897106-127897128 AGACCTGGCAGTGAGGAGGCCGG + Intronic
1061194181 9:129098501-129098523 AGCACAGGGATGGCGGGGGCAGG + Intronic
1061499124 9:130992174-130992196 AGTCCTGGGATGGGGGGGCCAGG + Intergenic
1061500829 9:131000959-131000981 AGAATTAGGGTGGCGGAGGCAGG + Intergenic
1062159267 9:135070684-135070706 AGAGCTGGGGTGGAGGAGGTGGG + Intergenic
1185478591 X:429661-429683 GGACCCTGGATGGCCGAGGCAGG - Intergenic
1189074959 X:37905582-37905604 AGACCAAGGATGGCGGGGGTGGG + Intronic
1191007050 X:55720737-55720759 AGGCATGGGATGGCTGAGGTGGG + Intronic
1191606248 X:63065930-63065952 TGACCTGAGATGCCGGAGGTTGG + Intergenic
1192121295 X:68458697-68458719 CTACCTGGGAGGGCTGAGGCAGG - Intergenic
1192203577 X:69082175-69082197 AGACCTGGGAGGGCAGGGGAAGG - Intergenic
1194384321 X:93235674-93235696 CTTCCTGGGATGGCCGAGGCTGG + Intergenic
1194670347 X:96724170-96724192 ACACTTTGGAAGGCGGAGGCGGG - Intronic
1195137849 X:101928601-101928623 ACACTTTGGAAGGCGGAGGCGGG - Intronic
1195702454 X:107715664-107715686 AGACCTGAGATGGAGGAGGGAGG + Intronic
1198186328 X:134257273-134257295 ACACCTTGGAAGGCTGAGGCAGG - Intergenic
1198632242 X:138653636-138653658 ATACCTGGGATGGCTTAGCCAGG + Intronic
1199700266 X:150370681-150370703 AGAGCTGGGGGGGTGGAGGCAGG - Intronic
1200231651 X:154446694-154446716 AGACCGGGGAGGGAAGAGGCTGG + Intronic