ID: 1023909160

View in Genome Browser
Species Human (GRCh38)
Location 7:44541463-44541485
Sequence GCCTCATCACGCAGGTGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 73}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023909157_1023909160 -10 Left 1023909157 7:44541450-44541472 CCGCTTTAGATGAGCCTCATCAC 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1023909160 7:44541463-44541485 GCCTCATCACGCAGGTGCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 73
1023909156_1023909160 -9 Left 1023909156 7:44541449-44541471 CCCGCTTTAGATGAGCCTCATCA 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1023909160 7:44541463-44541485 GCCTCATCACGCAGGTGCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 73
1023909146_1023909160 24 Left 1023909146 7:44541416-44541438 CCACTCCCACTGTTTGGCCCCAG 0: 1
1: 0
2: 1
3: 34
4: 385
Right 1023909160 7:44541463-44541485 GCCTCATCACGCAGGTGCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 73
1023909153_1023909160 0 Left 1023909153 7:44541440-44541462 CCACAGGCCCCCGCTTTAGATGA 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1023909160 7:44541463-44541485 GCCTCATCACGCAGGTGCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 73
1023909154_1023909160 -7 Left 1023909154 7:44541447-44541469 CCCCCGCTTTAGATGAGCCTCAT 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1023909160 7:44541463-44541485 GCCTCATCACGCAGGTGCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 73
1023909152_1023909160 5 Left 1023909152 7:44541435-44541457 CCAGTCCACAGGCCCCCGCTTTA 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1023909160 7:44541463-44541485 GCCTCATCACGCAGGTGCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 73
1023909145_1023909160 27 Left 1023909145 7:44541413-44541435 CCACCACTCCCACTGTTTGGCCC 0: 1
1: 0
2: 0
3: 20
4: 249
Right 1023909160 7:44541463-44541485 GCCTCATCACGCAGGTGCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 73
1023909155_1023909160 -8 Left 1023909155 7:44541448-44541470 CCCCGCTTTAGATGAGCCTCATC 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1023909160 7:44541463-44541485 GCCTCATCACGCAGGTGCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 73
1023909151_1023909160 6 Left 1023909151 7:44541434-44541456 CCCAGTCCACAGGCCCCCGCTTT 0: 1
1: 0
2: 0
3: 5
4: 125
Right 1023909160 7:44541463-44541485 GCCTCATCACGCAGGTGCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 73
1023909148_1023909160 18 Left 1023909148 7:44541422-44541444 CCACTGTTTGGCCCCAGTCCACA 0: 1
1: 0
2: 2
3: 15
4: 154
Right 1023909160 7:44541463-44541485 GCCTCATCACGCAGGTGCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 73
1023909150_1023909160 7 Left 1023909150 7:44541433-44541455 CCCCAGTCCACAGGCCCCCGCTT 0: 1
1: 0
2: 1
3: 22
4: 237
Right 1023909160 7:44541463-44541485 GCCTCATCACGCAGGTGCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 73
1023909147_1023909160 19 Left 1023909147 7:44541421-44541443 CCCACTGTTTGGCCCCAGTCCAC 0: 1
1: 0
2: 1
3: 13
4: 121
Right 1023909160 7:44541463-44541485 GCCTCATCACGCAGGTGCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023909160 Original CRISPR GCCTCATCACGCAGGTGCTA GGG Intergenic