ID: 1023909186

View in Genome Browser
Species Human (GRCh38)
Location 7:44541587-44541609
Sequence CTGGAGGCACAGATGGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023909176_1023909186 7 Left 1023909176 7:44541557-44541579 CCCTAACACTGCTGGAGTTGGTG No data
Right 1023909186 7:44541587-44541609 CTGGAGGCACAGATGGGACCAGG No data
1023909175_1023909186 8 Left 1023909175 7:44541556-44541578 CCCCTAACACTGCTGGAGTTGGT No data
Right 1023909186 7:44541587-44541609 CTGGAGGCACAGATGGGACCAGG No data
1023909177_1023909186 6 Left 1023909177 7:44541558-44541580 CCTAACACTGCTGGAGTTGGTGC No data
Right 1023909186 7:44541587-44541609 CTGGAGGCACAGATGGGACCAGG No data
1023909172_1023909186 20 Left 1023909172 7:44541544-44541566 CCACGCTATTAGCCCCTAACACT No data
Right 1023909186 7:44541587-44541609 CTGGAGGCACAGATGGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023909186 Original CRISPR CTGGAGGCACAGATGGGACC AGG Intergenic
No off target data available for this crispr