ID: 1023909958

View in Genome Browser
Species Human (GRCh38)
Location 7:44546832-44546854
Sequence ATAGAAAAGCAGGCTGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023909953_1023909958 9 Left 1023909953 7:44546800-44546822 CCAAGGTAGTGAGAGCCTGTCTC No data
Right 1023909958 7:44546832-44546854 ATAGAAAAGCAGGCTGGGCATGG No data
1023909954_1023909958 -6 Left 1023909954 7:44546815-44546837 CCTGTCTCTACAACAAAATAGAA No data
Right 1023909958 7:44546832-44546854 ATAGAAAAGCAGGCTGGGCATGG No data
1023909952_1023909958 14 Left 1023909952 7:44546795-44546817 CCTGGCCAAGGTAGTGAGAGCCT No data
Right 1023909958 7:44546832-44546854 ATAGAAAAGCAGGCTGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023909958 Original CRISPR ATAGAAAAGCAGGCTGGGCA TGG Intergenic
No off target data available for this crispr