ID: 1023910365

View in Genome Browser
Species Human (GRCh38)
Location 7:44551111-44551133
Sequence GTTCCATCAATTATTGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023910365_1023910366 0 Left 1023910365 7:44551111-44551133 CCATTTTCAATAATTGATGGAAC No data
Right 1023910366 7:44551134-44551156 AACTAGCCACAAGACCAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023910365 Original CRISPR GTTCCATCAATTATTGAAAA TGG (reversed) Intergenic
No off target data available for this crispr