ID: 1023921560

View in Genome Browser
Species Human (GRCh38)
Location 7:44634073-44634095
Sequence GCTCCAAGGGAGCTGGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023921560_1023921566 -7 Left 1023921560 7:44634073-44634095 CCCACTGCCAGCTCCCTTGGAGC No data
Right 1023921566 7:44634089-44634111 TTGGAGCTGAGGCTCACACCAGG No data
1023921560_1023921570 25 Left 1023921560 7:44634073-44634095 CCCACTGCCAGCTCCCTTGGAGC No data
Right 1023921570 7:44634121-44634143 ATGAAGGCCTCTGATGTGTCTGG No data
1023921560_1023921567 9 Left 1023921560 7:44634073-44634095 CCCACTGCCAGCTCCCTTGGAGC No data
Right 1023921567 7:44634105-44634127 CACCAGGCTAGAAGCCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023921560 Original CRISPR GCTCCAAGGGAGCTGGCAGT GGG (reversed) Intronic