ID: 1023926789

View in Genome Browser
Species Human (GRCh38)
Location 7:44675321-44675343
Sequence CTAAGAAAGAAGTGGAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 308}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023926789_1023926796 -7 Left 1023926789 7:44675321-44675343 CCCTGGCTCCACTTCTTTCTTAG 0: 1
1: 0
2: 1
3: 21
4: 308
Right 1023926796 7:44675337-44675359 TTCTTAGAATGACTTACGGGGGG 0: 1
1: 0
2: 1
3: 21
4: 358
1023926789_1023926794 -9 Left 1023926789 7:44675321-44675343 CCCTGGCTCCACTTCTTTCTTAG 0: 1
1: 0
2: 1
3: 21
4: 308
Right 1023926794 7:44675335-44675357 CTTTCTTAGAATGACTTACGGGG 0: 1
1: 0
2: 0
3: 10
4: 94
1023926789_1023926793 -10 Left 1023926789 7:44675321-44675343 CCCTGGCTCCACTTCTTTCTTAG 0: 1
1: 0
2: 1
3: 21
4: 308
Right 1023926793 7:44675334-44675356 TCTTTCTTAGAATGACTTACGGG 0: 1
1: 0
2: 0
3: 27
4: 188
1023926789_1023926797 -3 Left 1023926789 7:44675321-44675343 CCCTGGCTCCACTTCTTTCTTAG 0: 1
1: 0
2: 1
3: 21
4: 308
Right 1023926797 7:44675341-44675363 TAGAATGACTTACGGGGGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 49
1023926789_1023926795 -8 Left 1023926789 7:44675321-44675343 CCCTGGCTCCACTTCTTTCTTAG 0: 1
1: 0
2: 1
3: 21
4: 308
Right 1023926795 7:44675336-44675358 TTTCTTAGAATGACTTACGGGGG 0: 1
1: 0
2: 6
3: 146
4: 1136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023926789 Original CRISPR CTAAGAAAGAAGTGGAGCCA GGG (reversed) Intronic
900800558 1:4734570-4734592 CAAAGTAGGAAGTGGAGACAGGG + Intronic
901328384 1:8384138-8384160 CTGAGGAAGCAGTGGACCCAAGG - Intronic
901658661 1:10785306-10785328 CTAAGAAAGAAATGAAGAAAGGG - Intronic
901877113 1:12173208-12173230 CTAGGAAAGCATTGGAACCAGGG - Intronic
902114417 1:14109157-14109179 TTAAGAGTGAAATGGAGCCAAGG + Intergenic
904203203 1:28835227-28835249 CTAAGCCAGAAGCAGAGCCAGGG + Intronic
904265023 1:29313188-29313210 AAGAGAAAGATGTGGAGCCAGGG - Intronic
904631782 1:31848161-31848183 CCGAGACAGAAGTGGGGCCAGGG + Intergenic
904686244 1:32262844-32262866 GAAAGAAAGAAGTGGAGGAAGGG + Intronic
906034617 1:42742381-42742403 CAAAGAGAGAAAGGGAGCCACGG + Intergenic
906652432 1:47522175-47522197 GTAGGAAAGAAGTGGAGCTCTGG + Intergenic
907043000 1:51280222-51280244 TTAACAAAGAATTAGAGCCATGG - Intergenic
907450165 1:54541243-54541265 CTAAGAAGGAAGTGAATCCCCGG - Intergenic
907652299 1:56306696-56306718 CTAGGGAAGAAGAGGAGGCAGGG - Intergenic
911229258 1:95343166-95343188 CTTAGAAAGAAGCAGAACCAGGG - Intergenic
911374528 1:97035531-97035553 CAAAGAAAGAAGTGAACCCGGGG + Intergenic
912879470 1:113394793-113394815 CTAAGCAAGTAGTGTATCCAGGG + Intronic
913332430 1:117678617-117678639 CTCAAGAAGAAGTGGTGCCAGGG - Intergenic
913348193 1:117828956-117828978 CTAAGACAGTGGGGGAGCCAGGG - Intergenic
914928305 1:151907844-151907866 CCAGTAAAGAAGTGGGGCCAGGG - Intronic
915074528 1:153297619-153297641 GAAAGAAAGAAGAGGAGACAGGG + Intergenic
915406024 1:155660298-155660320 CTCAAAAAGAAGGGGAGCCAGGG - Exonic
915648876 1:157293307-157293329 CTCAGAAAGAGGTGGAGCTGAGG - Intergenic
916232953 1:162558344-162558366 CTCAGAAAGATGAGGAGCAATGG - Intergenic
916388523 1:164304731-164304753 CTAAGAATGAACTAGAGACATGG - Intergenic
917865068 1:179186625-179186647 TTAAGAAAGAAGTTGAGGCCGGG - Intronic
919682800 1:200453067-200453089 CTAAGAAAGAAGGGGAGAATGGG - Intergenic
919735135 1:200944438-200944460 CAAAGAAAGAAGTGGAAAGACGG - Intergenic
920356087 1:205374085-205374107 CAAACAATGAAGTGGAGCCCTGG - Intergenic
923727539 1:236520419-236520441 CTGAGGAAGGAGTGGAGCAAAGG - Intronic
1062799405 10:368376-368398 ATATTAAAGAAATGGAGCCAGGG + Intronic
1063278382 10:4597026-4597048 CTAAGAAAGAAAGAGAGGCATGG + Intergenic
1064980205 10:21158902-21158924 CTAAGAAAAAAGTGGAACCCTGG - Intronic
1067146598 10:43698744-43698766 CTCAGCAAGAAGAGGAGCCTGGG - Intergenic
1067773847 10:49147070-49147092 CTCAAAAAGAAGTTGAGCCTGGG - Intergenic
1070700573 10:78598816-78598838 TTAAGAACCAAGTGGAGTCATGG - Intergenic
1071572117 10:86703067-86703089 CTAACAGTGAATTGGAGCCAAGG + Intronic
1073688845 10:105785421-105785443 ATCAGAAAGTAGTGGAGCCAGGG - Intergenic
1074691028 10:116004236-116004258 CTAAGACAGAAGCCGAGCCCAGG + Intergenic
1075338138 10:121623633-121623655 AGAAGAAAGAAGTGGGACCAAGG - Intergenic
1075378720 10:122000592-122000614 TTAAGAAAGAAAAGGAGACAGGG - Intronic
1076280647 10:129243443-129243465 CTAAGAAACAAATGGGGCCTGGG - Intergenic
1077532211 11:3102695-3102717 ACAATAAAGAAGTGGAACCACGG + Intronic
1078283114 11:9922767-9922789 CTAAGTAAGAAGTGGAAAGAGGG - Intronic
1078820632 11:14877384-14877406 TTTAGAAAGAAGTGGTGCCAGGG + Intergenic
1080063422 11:27981640-27981662 CGAACAATGAACTGGAGCCAGGG - Intergenic
1080754195 11:35179776-35179798 CTGAGAAAGAAGTGGGGGAATGG + Intronic
1081045387 11:38267866-38267888 CTCAGCAAGCATTGGAGCCATGG + Intergenic
1083547895 11:63562785-63562807 CTAAGAAGGAATTGGAGGGAAGG + Intronic
1084772744 11:71354518-71354540 CCAAGAAAGAAGCAGAGCCAAGG + Intergenic
1085761533 11:79245453-79245475 TTAAGTAGGTAGTGGAGCCAGGG - Intronic
1087122298 11:94587757-94587779 CTAATAAAGAAGGTGAGACATGG - Intronic
1087314242 11:96587585-96587607 CTAAGAATGAAGTAGAACCAAGG - Intergenic
1087756407 11:102059345-102059367 CTACCATAGAAGTGTAGCCAAGG + Intronic
1090569376 11:128030146-128030168 CCAAGGAAGAAATGGGGCCAGGG + Intergenic
1092258986 12:6942382-6942404 CTTAGAGAGAACTGCAGCCAGGG + Intergenic
1092794221 12:12094220-12094242 CTAAGTAAGAGGTGGACCCAGGG + Intronic
1092888172 12:12943706-12943728 CAAGGAATGAAGTTGAGCCAAGG - Intronic
1093039424 12:14361451-14361473 ACAAGTAAGAAGTAGAGCCAAGG + Intergenic
1095420372 12:42018478-42018500 CTAAGAGAAGAGTGGACCCAGGG - Intergenic
1096590484 12:52655691-52655713 GTAAGAAAGGAGGGGAGCCTGGG - Intergenic
1096772969 12:53948128-53948150 AAAAAAAAGAAGAGGAGCCAGGG + Intergenic
1099010364 12:77284293-77284315 GAAAGAAAGAAATGGAGGCAGGG + Intergenic
1099910337 12:88824321-88824343 GTAGGAAAGAAGTGGAGAAAAGG - Intergenic
1100367070 12:93931768-93931790 CAAAGAAAAAAGAGGAGGCAAGG + Intergenic
1101221517 12:102646252-102646274 CTATGAAAGAAATGGAAGCAAGG + Intergenic
1101325605 12:103712855-103712877 CTAAAAAAGAATTTGAGCCCTGG + Intronic
1101601378 12:106213014-106213036 CCAAGAAAGCAGTGAAACCAGGG - Intergenic
1101688376 12:107049166-107049188 CTAACAAGGAAGAGGAGCCCTGG - Intronic
1102248683 12:111371035-111371057 CTAAGAAGAATGAGGAGCCATGG + Intergenic
1102808717 12:115805127-115805149 CTAAGGAAGAAGGGGAGTCTAGG - Intergenic
1103302601 12:119939546-119939568 CTAAGAAAGAAGTTGTTCTAAGG + Intergenic
1104964244 12:132501832-132501854 CGAAGGAAGGAGAGGAGCCACGG - Intronic
1105952382 13:25242106-25242128 CTAAGAAAGAAGTGTGACCATGG + Intergenic
1106277600 13:28227824-28227846 CTATGAAACAAAGGGAGCCATGG - Intronic
1107977958 13:45707793-45707815 CTGATAAAGGAGTGGAACCAGGG - Intronic
1109638935 13:65161431-65161453 GGAAGAATGGAGTGGAGCCATGG - Intergenic
1110576986 13:77068996-77069018 CTAAGAAACAAGTAAAGCTAAGG + Intronic
1111814390 13:93132417-93132439 CTAGGAATGACATGGAGCCAAGG - Intergenic
1112193616 13:97202960-97202982 CAAAACAAGAAGTGGAGCCAAGG - Intergenic
1112919779 13:104597874-104597896 CTCAGAAAGAAGGAGGGCCAGGG - Intergenic
1114145491 14:19972007-19972029 ATAAGACAGAAGTGGATTCAGGG - Intergenic
1114398150 14:22385300-22385322 CTAAGAAAAAAGTAGGCCCAAGG + Intergenic
1115541028 14:34421594-34421616 GAAAGAAAGAAGGGGAGACAGGG - Intronic
1115667357 14:35566199-35566221 GTAAGAAACAAGTGCAGCGAAGG + Intronic
1118324527 14:64772131-64772153 GTAGGTACGAAGTGGAGCCAGGG - Intronic
1119186006 14:72643059-72643081 GCAAGTAAGTAGTGGAGCCAGGG + Intronic
1123007929 14:105333364-105333386 CTAACACAGCAGTGGCGCCATGG - Intronic
1125730122 15:41888290-41888312 CTTCCAAAGAAGTGGAGCAAGGG + Intronic
1125888585 15:43248758-43248780 CAAAGAAGGAACTGCAGCCAAGG - Intronic
1126353094 15:47765504-47765526 AGAAGAGAGAAATGGAGCCAAGG + Intronic
1126592172 15:50351579-50351601 CAAAGAAAGAAGAGGTGCAAAGG + Intronic
1128851743 15:70965111-70965133 CTAAGAAAGACATGGAGATAAGG - Intronic
1129185660 15:73904651-73904673 CCAAGATAGATGTGGAGCCAGGG + Intergenic
1129426691 15:75468655-75468677 ACAAGAAAGAAGTTGATCCATGG + Exonic
1129604668 15:77019054-77019076 CAAAGGAAGAAGTGGGCCCATGG + Intronic
1130105566 15:80926103-80926125 GTAAGAAAGAAATGCAACCAAGG - Intronic
1132801260 16:1755171-1755193 CCAAGACAGACCTGGAGCCATGG + Intronic
1133474103 16:6103189-6103211 CTAAGAATGAAGAGGAGGCTTGG + Intronic
1133868166 16:9663262-9663284 CAAAGAAAACAGTGGAGCTAGGG + Intergenic
1133916026 16:10110740-10110762 CTGTGAAAGGAGTGGAGCCTGGG - Intronic
1134488623 16:14678818-14678840 CTGAGAGAGATGGGGAGCCAAGG - Intronic
1134890762 16:17839773-17839795 CTGAGAAAGAAGAGGAGGGAGGG + Intergenic
1135170817 16:20181708-20181730 CAAAGAAAGATTTGGAGCCCTGG - Intergenic
1137328035 16:47461204-47461226 CTAAAAAAGCAGTGGAGCTAGGG + Exonic
1137389783 16:48071679-48071701 CTGTGAATGAATTGGAGCCAGGG - Intergenic
1137636877 16:49994486-49994508 TAAAGAAAGAAGAGGAACCAAGG + Intergenic
1138161195 16:54756419-54756441 CACAGAAAGAAGTGCAGACATGG - Intergenic
1139926080 16:70487679-70487701 CTGGGAAAGAAGTGAGGCCAGGG - Intronic
1142626321 17:1194600-1194622 CTATGCAAGAAGTTGAGGCAGGG - Intronic
1144156521 17:12509105-12509127 GAAAGAAAGAAGTGGAGGGAAGG + Intergenic
1145304192 17:21663635-21663657 CAAAAAAAGAAGTGATGCCATGG + Intergenic
1149305858 17:55346010-55346032 CTAAGAAACAAGTGTAGGCCGGG + Intergenic
1150577532 17:66443362-66443384 CTTGGAAAGAAGTGTAGCCTTGG + Intronic
1150888222 17:69112331-69112353 TAAAGAAAGACGAGGAGCCAAGG + Intronic
1151092611 17:71460116-71460138 ATAAGAAAGAGCTGGAGCCTCGG + Intergenic
1151483402 17:74383625-74383647 GAAAGAAAGAAGTGGGGCAAGGG - Intergenic
1153255796 18:3169654-3169676 CTGACAAAGATGTGGAGACAAGG + Intronic
1154084742 18:11292763-11292785 CCAAGGAAGAAGTGAAGCCCTGG + Intergenic
1157559700 18:48637661-48637683 CTAAGAAAGATCTAGAACCAAGG - Intronic
1157562319 18:48657035-48657057 ACAACAAGGAAGTGGAGCCACGG + Intronic
1163159842 19:15457959-15457981 TGGGGAAAGAAGTGGAGCCACGG + Intronic
1163495405 19:17643798-17643820 CTGGGAAAGAAGTGGGGCCTAGG - Intronic
1164488958 19:28689407-28689429 GAAAGAAATAAGGGGAGCCAGGG + Intergenic
1165447959 19:35867023-35867045 CTCAGAAAGACTTGGACCCAAGG + Exonic
1165992858 19:39826087-39826109 CTAAAAAAGCAAAGGAGCCATGG + Intronic
1166020855 19:40027834-40027856 CTTAGAAGCAAGTGGAGGCAAGG + Intergenic
1166518347 19:43463525-43463547 CCAAGATAGAGGTGGAGCCGTGG - Intronic
1166729742 19:45052390-45052412 CTTAGAAATGGGTGGAGCCAGGG + Intronic
1167029183 19:46945879-46945901 TTAAGAAAGGACTGGGGCCAGGG - Intronic
1167837301 19:52084802-52084824 AGAAGAAAGAAAAGGAGCCAGGG - Exonic
925501283 2:4507922-4507944 TTAACAAGGAAGTGGAGCCGAGG - Intergenic
925811722 2:7707935-7707957 ACAAGAAATAAGTAGAGCCAGGG + Intergenic
927717628 2:25362805-25362827 CCGAAGAAGAAGTGGAGCCACGG + Intergenic
927760984 2:25753569-25753591 AGGAGAAAAAAGTGGAGCCATGG - Exonic
928241139 2:29587636-29587658 CAAAGGAAGAAGTGAAGCTATGG - Intronic
928337877 2:30413629-30413651 CTAAGAAGGATGTGGAGTCCGGG + Intergenic
928993277 2:37258433-37258455 TGATTAAAGAAGTGGAGCCATGG + Intronic
930098115 2:47582494-47582516 CTAAGAAAAAGGGGAAGCCATGG + Intergenic
930153507 2:48081419-48081441 CTCAGTAAGAAGTGCAGGCAAGG - Intergenic
930688279 2:54331803-54331825 TTAGGAATGATGTGGAGCCAGGG + Intronic
932427691 2:71651533-71651555 CAAAGAGAGAGCTGGAGCCAGGG + Intronic
934068752 2:88364479-88364501 TTAAAAAAGAAGAGGATCCAAGG + Intergenic
934096850 2:88614700-88614722 TTAAGAAAGAAGTGAGGGCATGG - Intronic
934675748 2:96248626-96248648 CCAAGAGGGAAGTGAAGCCATGG + Exonic
935188882 2:100759792-100759814 CAAAGAAACAAGTGCTGCCAAGG - Intergenic
935270202 2:101427768-101427790 CTAAGATAGACGTGGAACAATGG - Intronic
936149022 2:110001371-110001393 ATAAGAAAGAAGTGGCAGCAAGG + Intergenic
936195659 2:110369999-110370021 ATAAGAAAGAAGTGGCAGCAAGG - Intergenic
936233007 2:110720470-110720492 CTCAGAAAGATGTGGAGCCGAGG - Intergenic
936651506 2:114432477-114432499 ATAAGAAATCAGAGGAGCCATGG - Intergenic
936953256 2:117999535-117999557 CTTAGAAAGAGGAGGAGCAAAGG - Intronic
937040909 2:118819926-118819948 CTAGGAAAGAAATGCAGCCGTGG + Intergenic
937944243 2:127317243-127317265 CTTAAAAAGAAGTAGAGACAAGG - Intronic
939665373 2:144945140-144945162 GAAAGAAAGAAATGGAGTCATGG - Intergenic
940430420 2:153583851-153583873 CTGAGAAACAAGTGTAGCCTGGG + Intergenic
940549939 2:155141028-155141050 CCAAAAAAGAAGTGGAAGCAAGG - Intergenic
941872817 2:170403504-170403526 GTAAGAAACTAGTGGACCCAAGG + Intronic
942003159 2:171670840-171670862 CTGAGAATGCAGTGGAGACATGG - Intergenic
942794565 2:179802321-179802343 CTTAGAAAGAGGTGAAGCTAAGG - Intronic
944606248 2:201354322-201354344 CTAAGTGAGCAGTGGAGCAAAGG + Intronic
946043388 2:216801763-216801785 ATCAGAAAGAAGAGGAGGCAAGG - Intergenic
946608881 2:221436929-221436951 CAAAGAAAGAAGAGGAGAAATGG - Intronic
1168811587 20:708199-708221 CTCAGAAAGTAGTGGTGCCAGGG - Intergenic
1168871911 20:1136280-1136302 CTAATAAAGAGGCAGAGCCAGGG + Intronic
1168951783 20:1807146-1807168 CTAAGGAAGAAGGGGAGCATGGG + Intergenic
1169163120 20:3399501-3399523 CTAAGAAAGAAAAGGAGGCCGGG - Intronic
1170672069 20:18443737-18443759 CCGAGCAAGAAGTGGGGCCAAGG - Intronic
1172919816 20:38472103-38472125 CTGAGAAAGAAGAGGAGGGAGGG - Intergenic
1175224151 20:57435062-57435084 CTAAGTAGGAAGGGGAGACAAGG - Intergenic
1175547602 20:59788646-59788668 ATCAGAAAGAGCTGGAGCCAGGG - Intronic
1176938313 21:14893033-14893055 GTAAGAAAGACTTGGGGCCAGGG - Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178631282 21:34263575-34263597 CCCAGTAAGAAGTGGAGACAAGG - Intergenic
1181901834 22:26162472-26162494 CTAAGAAAGATTTAAAGCCAAGG + Intergenic
1183738367 22:39656376-39656398 CTAAGAGAGAGCTGGCGCCAGGG - Intronic
1184784178 22:46663815-46663837 CTAAGAGAGAAGGGGAGAGATGG - Intronic
949289330 3:2445410-2445432 CGAAGATAGAGGTGGAACCAAGG + Intronic
949365021 3:3271544-3271566 CTAATAAAGAACTGGAGGCCAGG - Intergenic
949742733 3:7254715-7254737 CAAAGAAAATGGTGGAGCCAGGG - Intronic
949890477 3:8730178-8730200 CTAAGAAAGTAATGGTACCATGG - Intronic
950115746 3:10449482-10449504 CAAAGAAATGAGTCGAGCCATGG - Exonic
951511348 3:23506232-23506254 GTAAGAAAGAACTTGACCCATGG - Intronic
954363737 3:50135585-50135607 TTAAAAAAGAAGTGGAGGAAGGG + Intergenic
954382282 3:50226104-50226126 CTTAGAAAGAAGAGCAGCCCTGG + Intergenic
955415231 3:58685574-58685596 TTGAGAAATGAGTGGAGCCAGGG + Intergenic
955446893 3:59021493-59021515 CTAAGAAGGCAGTGTAGGCAGGG - Intronic
955523327 3:59796023-59796045 ATAGGAAAGAGGTGGAGACAGGG + Intronic
956380033 3:68655362-68655384 CTAAGAAAGAAATGGATACATGG - Intergenic
956527320 3:70179264-70179286 CTCAAAAAGAAGGGGAACCAAGG - Intergenic
958631605 3:96690627-96690649 GTATGAAAGAAAAGGAGCCAAGG + Intergenic
958703373 3:97621573-97621595 CTAAGAAGAAAGTTGAACCAGGG + Intronic
959517999 3:107291224-107291246 GGAAGACAGAAGGGGAGCCAGGG + Intergenic
961193914 3:124985513-124985535 CTAAGAAAAGGGTGGAGGCAAGG + Intronic
961208245 3:125104605-125104627 CTAAGAAAGAAGGAGAGATAAGG - Intronic
961960207 3:130846770-130846792 AGAAGAAAGAATTGGATCCAAGG - Intergenic
962488592 3:135868595-135868617 CTAAGACAAAATTGGAACCAAGG - Intergenic
962585265 3:136836381-136836403 CTGAGGAAGAATTGGGGCCAAGG - Intronic
963552827 3:146745763-146745785 CACGGATAGAAGTGGAGCCATGG - Intergenic
964588619 3:158336254-158336276 CCAAGAAAGAAAGGCAGCCAGGG - Intronic
964652510 3:159027449-159027471 CTAACAAAGATGTGGAGAAAAGG + Intronic
965168373 3:165226630-165226652 CTAAGAAAGAATTGGTAACATGG - Intergenic
965281352 3:166758135-166758157 ATAAGTGAGAAATGGAGCCAGGG + Intergenic
965788714 3:172364474-172364496 CTAAGATGGCAGTGGAGGCAGGG - Intronic
965990325 3:174810401-174810423 CTTACTAAGAAGTGGAGCAAAGG + Intronic
966904336 3:184510870-184510892 CCAGGAAAGAAGTGGTACCAAGG + Intronic
967264037 3:187674417-187674439 TTAAGAGAGAAGAGGAGCCAGGG + Intergenic
967270082 3:187725846-187725868 CCAAGAAACAAGTGGTGGCACGG + Intronic
968971257 4:3796486-3796508 CTAAGGAAGGAGTGGGGGCAGGG + Intergenic
969210674 4:5684850-5684872 CTAGGACAGACGTGCAGCCAGGG + Intronic
970265982 4:14286833-14286855 CTAAGAAAGTAATGGAGGCATGG + Intergenic
971226312 4:24754828-24754850 CTAGGAAGGAAGTAGAGCAAGGG + Intergenic
972540545 4:40035403-40035425 TTAAAAAAGAAGTGGAGGCTGGG + Intergenic
972850552 4:43044494-43044516 ATAAGAAAGAAGTTGATTCAAGG + Intergenic
973720405 4:53718194-53718216 CTAAGAAAAAAGAGGAGGCTGGG + Intronic
974052293 4:56952388-56952410 CTGAGACAGAAGGGGAGGCAGGG - Intergenic
974181618 4:58390912-58390934 CTAAGGAATAAGTTGAACCAAGG - Intergenic
974241394 4:59253175-59253197 CTGAGGAGGCAGTGGAGCCAAGG - Intergenic
974969281 4:68804638-68804660 CTTAGAAAGGGGAGGAGCCAAGG - Intergenic
975890577 4:79022511-79022533 CTAAGAAAGAACTGCATTCAAGG + Intergenic
976238105 4:82922269-82922291 CTAAGAAAGAAGTACAGCAACGG - Intronic
977324461 4:95557038-95557060 AGAAGAAAGAACTGGAGCCACGG + Intergenic
978744818 4:112180734-112180756 AGATGAAAGAAGAGGAGCCAAGG + Intronic
979632543 4:122920269-122920291 GTAAGAAAGGTGTAGAGCCAGGG + Intronic
980407108 4:132367128-132367150 CTCATCAAGAACTGGAGCCAAGG - Intergenic
980415970 4:132489028-132489050 CTTAGAAATAAGTTTAGCCAAGG + Intergenic
980642684 4:135599931-135599953 CTCAGAAAGAAGTGAAGATAAGG - Intergenic
981406487 4:144375757-144375779 GTAAGAAAGAAGTGAGGCAAGGG + Intergenic
981653811 4:147089357-147089379 TAAAGAAAGAAATGGAGCCAAGG - Intergenic
984485899 4:180368847-180368869 CTAAGTAAGAACAGGAGGCATGG + Intergenic
985065537 4:186117446-186117468 CTAAGAGAGAAGAGGAGGCGCGG + Intronic
985095779 4:186411660-186411682 CTTGGAAAGAAGTGGAATCAGGG - Intergenic
986357336 5:6941830-6941852 CTTAGAAGGCAGTGGTGCCAGGG + Intergenic
989515766 5:42340586-42340608 CTTATAAGGAAGTGGAGCAAAGG - Intergenic
990359071 5:54999352-54999374 CTAAGAGAGAATGAGAGCCAAGG - Intronic
990667322 5:58087978-58088000 CTGAGAAACAAGTAGAACCAAGG - Intergenic
991997226 5:72400115-72400137 CCAAGAAAGAAGAGGAGAGAAGG - Intergenic
992028066 5:72691063-72691085 CTCAGAAAGTAGTGGAGCTGCGG - Intergenic
992761197 5:79952203-79952225 ATAAGAAAGAATGGGAGGCAGGG - Intergenic
992846294 5:80752204-80752226 CGAAGAAAGAAAAGTAGCCAAGG + Intronic
993830263 5:92747908-92747930 CAAGGGAAGAAGAGGAGCCAAGG + Intergenic
994338394 5:98597013-98597035 TTAAGAGAGAAGTGTTGCCAAGG - Intergenic
995130799 5:108628424-108628446 CTAAAAATCAAGTGGACCCAAGG + Intergenic
997427974 5:133817246-133817268 GCAAGTAAGGAGTGGAGCCAGGG + Intergenic
998455721 5:142271277-142271299 GAAAGAAAGAAGTGGAGGGAAGG + Intergenic
1000105032 5:158051596-158051618 CAAAGAAGGAAGTGAAGACAGGG - Intergenic
1000579335 5:163015834-163015856 CTAAGGAAGAAATGGAGAAATGG + Intergenic
1002667371 5:180835064-180835086 CTAAGAAAGAAATGGTAGCATGG + Intergenic
1002834810 6:857143-857165 CTAAGAAAAAAATGCAGCGATGG - Intergenic
1002850988 6:996210-996232 CTAAAAAGAAAGTGAAGCCATGG + Intergenic
1003698927 6:8440745-8440767 CTGGGAAAGAAGAGGAGTCATGG - Intergenic
1004884003 6:20034761-20034783 GGAAGAAAAAAGTGTAGCCAAGG - Intergenic
1005718668 6:28579232-28579254 CTAAGAAAGAAGGTGAGACTTGG - Intronic
1007469228 6:42077511-42077533 CCTAGAAAGAAGAGGAACCATGG - Exonic
1007676629 6:43601168-43601190 CTAATTAAGGACTGGAGCCAGGG + Intronic
1008475303 6:51929879-51929901 CAAAGACAGAAGTCCAGCCAAGG + Intronic
1009967021 6:70588643-70588665 CAAAGAAAAAGGTGGACCCAGGG + Exonic
1010497877 6:76557783-76557805 CTAAGTAAGAAGTGGGGAAAAGG - Intergenic
1011406393 6:87019550-87019572 GGAAGAAAGATGTGAAGCCATGG - Intergenic
1013790267 6:113828427-113828449 GTTAGAAAGCAGTGAAGCCAAGG + Intergenic
1015296418 6:131598442-131598464 ATTAGAGAGAATTGGAGCCAGGG - Exonic
1015753317 6:136583287-136583309 ATAAGAACGAAGTTCAGCCATGG + Intronic
1015917555 6:138232933-138232955 CTAAGACTGAGGGGGAGCCAGGG - Intronic
1016037002 6:139393561-139393583 CTACAAAAGAAGAGGAGCAATGG + Intergenic
1017131711 6:151113518-151113540 CCAAGACAGAGGTGGAGGCAGGG + Intergenic
1019754703 7:2760493-2760515 CCCAGAAGGAAGTGAAGCCACGG - Intronic
1019870115 7:3752695-3752717 CAAAGAAAGAAATGGATTCACGG - Intronic
1023203697 7:37725321-37725343 AGCAGAAAGAAGTGAAGCCAGGG + Intronic
1023567179 7:41534897-41534919 TTAAGAAAAAAATAGAGCCAGGG + Intergenic
1023926789 7:44675321-44675343 CTAAGAAAGAAGTGGAGCCAGGG - Intronic
1024165044 7:46722635-46722657 CTCAGACAGACGTGGAGCCTTGG + Intronic
1025155960 7:56606109-56606131 CCAGGAAAGAAGGGGGGCCAGGG - Intergenic
1025158848 7:56635650-56635672 CTAAGAAAGTAGTGTAGGCTGGG - Intergenic
1025743717 7:64224297-64224319 CAAAGAAAGAAACAGAGCCAGGG + Intronic
1028649100 7:93130482-93130504 CTAAGAAACAGGTGGAGATAAGG + Exonic
1030333631 7:108299322-108299344 CTAGGAAAGAAGAGGTGGCATGG + Intronic
1030402634 7:109071134-109071156 CTAAGAAAATAATGGAACCAGGG - Intergenic
1031681817 7:124684098-124684120 CTAAGATAGAAGGGGAGGCTTGG - Intergenic
1032092518 7:128918098-128918120 CTAGGATAGCAGTGGTGCCAGGG + Intergenic
1032884818 7:136125834-136125856 AGGAGAAAAAAGTGGAGCCAAGG + Intergenic
1034147263 7:148884229-148884251 CTCAGAAGGCAGTGGAGCCCCGG - Exonic
1035305009 7:157926547-157926569 CTAAATGAGAAGTGGAGGCAGGG + Intronic
1036211327 8:6843540-6843562 GGAAGAAAGAAATGCAGCCAGGG - Intergenic
1037157039 8:15714629-15714651 CTAAGAAAGAAGTATAACCTTGG - Intronic
1037523905 8:19706407-19706429 CTAAGAGAGCAGTGGAGCCACGG + Intronic
1038384575 8:27130158-27130180 AAAAGAAAGAAGTAGAGCCTGGG + Intergenic
1038673584 8:29602162-29602184 TTAAGAAAGTAGTGGTGCCTGGG - Intergenic
1039532127 8:38272198-38272220 CTAAAAAAGTAATGGAGGCAGGG - Exonic
1040532222 8:48275257-48275279 CAAAGAAAGGTGTGGAGACAGGG + Intergenic
1041109787 8:54473418-54473440 CTAAAGAAGAAGTGCAGCGATGG - Intergenic
1042379677 8:68098694-68098716 TCAAGAAAGAAATGTAGCCAAGG + Intronic
1042444582 8:68869228-68869250 AAAAGAAAGAAGTGGAGAAAGGG - Intergenic
1042558953 8:70058171-70058193 GTAAGAAGGAAGTGAAGGCACGG - Intronic
1042747317 8:72121530-72121552 CCAAGAAAGCAGAGGATCCATGG + Intergenic
1043245876 8:78000422-78000444 CTGGGAAAGAAGTGGAGCTGGGG + Intergenic
1043880882 8:85541225-85541247 CGAAGCATGAAGTGCAGCCAAGG + Intergenic
1044781791 8:95751078-95751100 CCAAGGGAGCAGTGGAGCCAGGG - Intergenic
1045712654 8:105003319-105003341 TTAAGAAGGATGAGGAGCCATGG - Intronic
1048021564 8:130544238-130544260 GAAAGAGAGAAGTGGAGACAAGG - Intergenic
1048558896 8:135511119-135511141 CTAAGAAAGTAGAGGAAGCATGG + Intronic
1049951698 9:650862-650884 CAAGGAAAGAAGTGGAGGGAAGG + Intronic
1050072657 9:1832704-1832726 GTAAGAAGGAAGTGGTGGCAGGG + Intergenic
1051024984 9:12597963-12597985 CAAAATAAGAAATGGAGCCATGG + Intergenic
1053388831 9:37718550-37718572 ATAAGAGCGAAGTGGAGCCAAGG + Intronic
1055368967 9:75576271-75576293 CTAAGGAAGAATTGAAGCGAAGG + Intergenic
1055879968 9:80989212-80989234 GTAAGAAAGAAGTAGGGCAAAGG - Intergenic
1056635452 9:88327799-88327821 CTAAGAAAGGACTACAGCCAGGG + Intergenic
1058395964 9:104554778-104554800 CTTAGAAATAAGTGTAACCAAGG + Intergenic
1058427555 9:104888198-104888220 CCAGGAAAGCAGTGGGGCCAGGG - Intronic
1060463558 9:123882067-123882089 CTAAGCAATGAGTGGAGACAGGG - Intronic
1060485210 9:124042174-124042196 GCCAGAAAGCAGTGGAGCCAGGG + Intergenic
1060526435 9:124323768-124323790 CTGAGAGAGAAGAGGAGACATGG + Intronic
1203704847 Un_KI270742v1:30347-30369 ATAAGAAAGAAGTTGAGGCTAGG + Intergenic
1186343226 X:8664788-8664810 GCAAGAAAGAAGAGCAGCCACGG + Intronic
1186511738 X:10134901-10134923 CTAAGGAACAAGTGGAAGCAGGG + Intronic
1186699689 X:12076960-12076982 CTATGAAAGAACTGGAGGCAGGG - Intergenic
1188248291 X:27859860-27859882 CTACGAAGGGAGTGGAGACAGGG - Intergenic
1189023249 X:37364601-37364623 CTAAGAAAGAAATGGAGAATGGG - Intronic
1189877118 X:45447546-45447568 CCAACAGAGAAGTGGAGCCTGGG - Intergenic
1190365312 X:49687864-49687886 CTCAGAAAGTACTGGAGTCATGG + Intronic
1190426321 X:50337166-50337188 CAAAAGAAGAAGTGAAGCCATGG - Intronic
1190527334 X:51341485-51341507 CTGATAAAGAACTGGACCCAAGG - Intergenic
1191110314 X:56799145-56799167 CAAAGAGAGCTGTGGAGCCAGGG - Intergenic
1191155032 X:57265297-57265319 CTAAGAAAGAAGTTGAATCCAGG + Intergenic
1192057006 X:67783330-67783352 CTATGAAAGAAGTGGAGAACAGG + Intergenic
1192545190 X:72007108-72007130 CTAGGAAAGAGAAGGAGCCAAGG + Intergenic
1194029255 X:88790453-88790475 CTGAGAATGACATGGAGCCAAGG - Intergenic
1196250362 X:113452994-113453016 CTAAGAAACTACTGAAGCCAGGG + Intergenic
1197159409 X:123307008-123307030 TTAGAAAAGAAGTGAAGCCATGG - Intronic
1201383223 Y:13409330-13409352 CTCAGAAAAAAGTGGAGCTGAGG - Intronic
1201545865 Y:15161388-15161410 CCAAGAAAGAAGTGAGCCCATGG + Intergenic