ID: 1023927047

View in Genome Browser
Species Human (GRCh38)
Location 7:44676979-44677001
Sequence ATGACCAGAAATGGTGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 236}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023927047_1023927050 -7 Left 1023927047 7:44676979-44677001 CCTGCTTCACCATTTCTGGTCAT 0: 1
1: 0
2: 0
3: 10
4: 236
Right 1023927050 7:44676995-44677017 TGGTCATGTGACTGAGTGTTGGG No data
1023927047_1023927049 -8 Left 1023927047 7:44676979-44677001 CCTGCTTCACCATTTCTGGTCAT 0: 1
1: 0
2: 0
3: 10
4: 236
Right 1023927049 7:44676994-44677016 CTGGTCATGTGACTGAGTGTTGG No data
1023927047_1023927052 -5 Left 1023927047 7:44676979-44677001 CCTGCTTCACCATTTCTGGTCAT 0: 1
1: 0
2: 0
3: 10
4: 236
Right 1023927052 7:44676997-44677019 GTCATGTGACTGAGTGTTGGGGG No data
1023927047_1023927051 -6 Left 1023927047 7:44676979-44677001 CCTGCTTCACCATTTCTGGTCAT 0: 1
1: 0
2: 0
3: 10
4: 236
Right 1023927051 7:44676996-44677018 GGTCATGTGACTGAGTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023927047 Original CRISPR ATGACCAGAAATGGTGAAGC AGG (reversed) Intronic
901203795 1:7482594-7482616 ATGCCCAGAAAGGGTGACCCTGG + Intronic
901754911 1:11435543-11435565 ATCACAGGAAATGGTGCAGCAGG - Intergenic
901897841 1:12329874-12329896 ATCTCCAGAAAGGGTGAAGTGGG - Exonic
902150374 1:14438134-14438156 ATGAACAGAAACAGAGAAGCAGG - Intergenic
904116309 1:28164388-28164410 AGGACTAGAAGTGGTGAAGGCGG + Intronic
905188310 1:36212966-36212988 ATGAGCAGGAATGAGGAAGCAGG + Intergenic
905475417 1:38223619-38223641 ATGGCCAGATATGGTGCAGGGGG + Intergenic
907993074 1:59601489-59601511 AAGATCAGAAATGATGGAGCTGG - Intronic
908081784 1:60588568-60588590 ATGAAGAGAAATAGTGAAGAGGG + Intergenic
909798999 1:79781470-79781492 ATGACCAGAACAGCTAAAGCAGG + Intergenic
911403208 1:97402647-97402669 ATGAAAAGAAATGGTGAAAGGGG + Intronic
912009966 1:104947436-104947458 ATGTCCAGGAATTTTGAAGCAGG + Intergenic
912043619 1:105423790-105423812 TTGACCAGAACTGGTGAAAGGGG + Intergenic
912851155 1:113126073-113126095 ACAATCAGAAATGGTGAATCTGG - Exonic
915276089 1:154789209-154789231 AGGACGAGTGATGGTGAAGCAGG - Intronic
917028593 1:170666469-170666491 ACGTGCAGAATTGGTGAAGCTGG - Intronic
919093757 1:193004771-193004793 TTGAGTAGAAATGGTGAAGAGGG - Intergenic
919420955 1:197369689-197369711 AAGACCAGAAATGATGAACTGGG - Intronic
919661354 1:200251052-200251074 ACTACCAGAAATGGTAAGGCTGG - Intergenic
920574180 1:207044676-207044698 ATGACAAGAAATGGGGAAGAAGG + Exonic
921566842 1:216731721-216731743 ATTACCAGGAATGGTGATGGGGG + Intronic
924357842 1:243202290-243202312 ATAATCAGAAGTGGGGAAGCCGG + Intronic
1063522638 10:6754861-6754883 AGGACAAGAATTGTTGAAGCCGG + Intergenic
1065983343 10:30925242-30925264 TTGAACAGAAATGGTGATACTGG + Intronic
1071100225 10:82028247-82028269 ATGACCAGAAGTCTGGAAGCAGG - Intronic
1072606307 10:96985903-96985925 AAGACCAGAAATGAAGAAGATGG - Exonic
1073161403 10:101399862-101399884 ATGACAAGAAATTGTGAAATGGG - Intronic
1074324450 10:112434968-112434990 ATGACCAGGAAAGGTGTAACAGG + Intronic
1076991086 11:274988-275010 AAGACCAGAAAAGGAGAAGAGGG - Intergenic
1078844095 11:15106439-15106461 ATGATAAGAAATGGTGGAGGGGG + Intergenic
1078899277 11:15626446-15626468 ATTCCCAGAAACTGTGAAGCTGG - Intergenic
1079124946 11:17712375-17712397 ATGACTAGAAGTGTTCAAGCAGG - Intergenic
1079270414 11:18979963-18979985 TTGAACAGAAATGGTGAAAGTGG + Intergenic
1081078626 11:38710080-38710102 GTGGACAGAAAGGGTGAAGCTGG + Intergenic
1081525192 11:43923314-43923336 ATGACCAGAAAAGGCAAAGTGGG - Intergenic
1081960005 11:47129067-47129089 TTGAACAGAAATGGTTAAACAGG - Intronic
1082798759 11:57398104-57398126 GTGACCACAAAAAGTGAAGCAGG - Intronic
1085011422 11:73143761-73143783 ATGACCAGAAATTGAAAAGGTGG + Intergenic
1085579028 11:77634306-77634328 ATGCCCAGAGATGATAAAGCTGG - Intronic
1086578494 11:88368773-88368795 ATGACCAGGGATGGTGATGGAGG + Intergenic
1087719502 11:101646141-101646163 TTGAATAGAAATGGTGAAGGAGG - Intronic
1091702523 12:2673521-2673543 AAGTCCAGCAGTGGTGAAGCTGG + Intronic
1091890117 12:4046674-4046696 CTGACCACAATTGGTGCAGCTGG - Intergenic
1093391058 12:18622567-18622589 ATGCCCAGAAATGGGGTTGCTGG + Intronic
1096935933 12:55276211-55276233 ATGACCAGAAATGGGATTGCTGG + Intergenic
1097018291 12:56002614-56002636 ATCACCAGAGAAGGTGAGGCTGG - Exonic
1101232951 12:102760221-102760243 ATGACCAGAAAAGCTGCAGAAGG - Intergenic
1101519594 12:105469144-105469166 ATGCCCAGAGCAGGTGAAGCAGG - Intergenic
1101754487 12:107610286-107610308 ACGAACAGACCTGGTGAAGCAGG + Exonic
1102996429 12:117354880-117354902 ATGACAAGAAATGCTTTAGCTGG + Intronic
1103404374 12:120664921-120664943 ATGAAAAGACATGGTGAAGAGGG + Intronic
1103428592 12:120861496-120861518 ATGACCAGAAATGTGGCTGCTGG - Intronic
1105463323 13:20611905-20611927 ATGAACAGAACTGGTGAAAGTGG - Intronic
1105686850 13:22792661-22792683 ATGAGGAGAAAAGCTGAAGCTGG + Intergenic
1106876063 13:34074949-34074971 ATAACCAAGAATGGTGAAGTAGG - Intergenic
1107215608 13:37914881-37914903 ATGAACACAAAGGGTGAGGCTGG + Intergenic
1108028152 13:46200246-46200268 AAGAAGAGAAATGTTGAAGCTGG + Intronic
1108154257 13:47569499-47569521 ATGACCAGTAATGGGATAGCTGG - Intergenic
1108441497 13:50457666-50457688 ATGACCAGAGATGTTGAGTCAGG - Intronic
1110635204 13:77759469-77759491 TTGACTAGAAATGGTGAAAGTGG + Intronic
1111216710 13:85152403-85152425 ATCAGCAGAAATGTTGAGGCTGG - Intergenic
1112573478 13:100614695-100614717 TAGACTAGAAATGGTAAAGCAGG + Intronic
1117454838 14:55886614-55886636 AAGGACAGAAATTGTGAAGCTGG - Intergenic
1117599413 14:57359956-57359978 TTGACCAGATAAGCTGAAGCAGG - Intergenic
1117628283 14:57663064-57663086 CCAACAAGAAATGGTGAAGCAGG - Intronic
1117641770 14:57807686-57807708 ATGGCCAGAAATTGTGATGTTGG - Intronic
1121377744 14:93430200-93430222 ATGTCCACGGATGGTGAAGCTGG - Intronic
1122815708 14:104311497-104311519 ATATCGAGACATGGTGAAGCGGG - Intergenic
1122875695 14:104663621-104663643 ATGACCAACAGTGTTGAAGCAGG + Intergenic
1123700596 15:22912148-22912170 ATGAACAGAAATGGAGCTGCAGG + Intronic
1124385474 15:29204842-29204864 ATGCCGACAAATGGTGAAGATGG - Intronic
1124465437 15:29935509-29935531 ATGACCATAGGTGGTGAAGCAGG - Intronic
1125882124 15:43204104-43204126 ATGACAGGAAAAGGTGAGGCTGG - Intronic
1126416430 15:48422459-48422481 ATAAAGAGAAATGTTGAAGCTGG + Intronic
1128041518 15:64578715-64578737 ATGACCAGACATGGTGGCTCAGG + Intronic
1128526514 15:68415843-68415865 ATGCTCAGAAAGAGTGAAGCAGG + Intronic
1128580266 15:68805095-68805117 CTGACCAGAGATGGTGAGGCAGG - Intronic
1129676405 15:77634284-77634306 GTACCCAGAAATGGTGCAGCTGG - Intronic
1130976616 15:88781334-88781356 ATGTTCAGAAATGGTTAAGATGG + Intergenic
1131462798 15:92630558-92630580 ATGACCATAAGTGGGGCAGCAGG - Intronic
1131943969 15:97598755-97598777 CTGACCAGACATGGAGAAGGAGG + Intergenic
1132948025 16:2543404-2543426 CTCACCAGAAAAGGGGAAGCAGG - Intronic
1132966422 16:2657938-2657960 CTCACCAGAAAAGGGGAAGCAGG + Intergenic
1134360206 16:13524024-13524046 CAGTCGAGAAATGGTGAAGCTGG + Intergenic
1135469777 16:22719796-22719818 GTGAGCAGAAATGGAGAAGAAGG + Intergenic
1135740658 16:24972539-24972561 TTGTCCAGAAATGGGGCAGCTGG - Intronic
1137468427 16:48732438-48732460 AAGACCAGAAATGGATCAGCTGG - Intergenic
1138434240 16:56988479-56988501 ACAACCAGGAGTGGTGAAGCTGG + Intergenic
1143715821 17:8768304-8768326 ATCTCCAGCAATGGCGAAGCTGG + Intergenic
1144635830 17:16908397-16908419 ATGACCAGAAATTGTCATGTGGG + Intergenic
1147561505 17:41512235-41512257 AAGCCAGGAAATGGTGAAGCTGG - Intergenic
1148332448 17:46820533-46820555 CTGACCAGGAGTGGTGAACCTGG + Intronic
1149416972 17:56469585-56469607 ATAACCAGAAAGGGTGGAGTCGG - Intronic
1154010731 18:10571925-10571947 ATAACCACAAATGGGGAATCAGG + Intergenic
1156133974 18:34013561-34013583 AGGACTAGAAATGCTGAAGATGG - Intronic
1158981581 18:62767055-62767077 ATTACAAGAAATGGTGGAGGGGG + Intronic
1159108672 18:64031418-64031440 GAGACCAGAAATGGGGAACCGGG - Intergenic
1162138963 19:8573971-8573993 ATGATCAGCAATGGTGGTGCTGG - Intronic
1167226966 19:48251519-48251541 AGGACCAGAAATGGTGAAATTGG - Intronic
1168505132 19:56927726-56927748 AAGACCAGGAATGATGAAGGAGG + Intergenic
926995240 2:18728222-18728244 ATGCTGAGAAATGGTAAAGCTGG - Intergenic
929875763 2:45795153-45795175 AAGACCAGAAACTGTGAGGCTGG - Intronic
930076806 2:47412539-47412561 ATTGCCAGAAATGGAGAATCAGG + Exonic
930490431 2:52062178-52062200 CTGAACAGAAATGGTGAAAGTGG - Intergenic
931022771 2:58068361-58068383 ATCATCAGAAATGATGAAGATGG - Intronic
931249281 2:60515791-60515813 AGGGGCAGAAATGGGGAAGCTGG - Intronic
931348500 2:61468656-61468678 ATGACCAGATTTTGAGAAGCTGG + Intronic
932123726 2:69124858-69124880 TTCAGCAGAAATGGGGAAGCTGG - Intronic
933497667 2:83070466-83070488 ATCTCTAGAAATGGAGAAGCTGG - Intergenic
934110160 2:88734762-88734784 ATGACCAGAAATGCTGAGTTGGG - Intronic
935560463 2:104553742-104553764 ATGAAGAGAAATGGTGAGGTGGG + Intergenic
936347108 2:111683371-111683393 GTGAGCAGACATGCTGAAGCTGG - Intergenic
936861989 2:117029831-117029853 ATGACCAGACAGGTTTAAGCGGG + Intergenic
938636271 2:133230145-133230167 ATGATCAGCAATGGTCAAGAAGG + Intronic
941145035 2:161834033-161834055 ATGCCCAGAAATGGTCATGGTGG - Intronic
943770813 2:191714341-191714363 ATGTAAAGGAATGGTGAAGCAGG - Intergenic
946214044 2:218169776-218169798 ATGAGAAGAGATGCTGAAGCTGG - Intergenic
948772102 2:240256829-240256851 GTGACCAGCAATGGTGGAGCAGG - Intergenic
1170175997 20:13470745-13470767 AGGATCAGAAATGATGAAGAAGG - Intronic
1171840686 20:30206852-30206874 TTGATCAGGAATGGGGAAGCTGG + Intergenic
1173485398 20:43437446-43437468 AAGTCCAGAAATGGTATAGCAGG + Intergenic
1173553476 20:43949290-43949312 GTGACAAGTAATAGTGAAGCGGG - Intronic
1173707663 20:45124346-45124368 GTGAGCAGACATGGTGGAGCTGG - Intronic
1174115773 20:48225435-48225457 AGGTTCAGAAGTGGTGAAGCTGG - Intergenic
1174164869 20:48577474-48577496 AGGTTCAGAAGTGGTGAAGCTGG + Intergenic
1174829438 20:53799129-53799151 ATGACCACAAGTGGTGCAGGAGG + Intergenic
1175770010 20:61617635-61617657 CTGACGTGAAAAGGTGAAGCAGG + Intronic
1178928074 21:36792438-36792460 ATGACAAGAAAAGGAGAAGGGGG + Intronic
1182226052 22:28800030-28800052 ATGACCAGAGCTGGGGATGCGGG - Intronic
1183593919 22:38798268-38798290 ATGACCAGAAAGGCTGTATCAGG - Intergenic
1184248419 22:43247157-43247179 ATGGCCAGTGATGGTGAAGAAGG + Intronic
950911260 3:16595348-16595370 ATGACCTGAACTGGTGAATTTGG + Exonic
951704854 3:25534192-25534214 AGGTCAACAAATGGTGAAGCTGG - Intronic
952577709 3:34794811-34794833 ATGGGCAGAAATGTTGCAGCTGG + Intergenic
952836631 3:37607930-37607952 ATGGCCATTAATGGTGAAGACGG - Intronic
952885954 3:38011064-38011086 AGGACCAGAAAGTGTGGAGCAGG + Intronic
953131888 3:40147773-40147795 ATGAAGAGAAATGGTGAAGAAGG - Intronic
955844681 3:63149773-63149795 ATTTACAGAAATGGGGAAGCTGG + Intergenic
956283393 3:67583174-67583196 ATGGCCAGAGATGGTGTGGCAGG - Intronic
959040365 3:101415234-101415256 ATGACCAGAAATGGGGATCAAGG - Intronic
959538889 3:107518327-107518349 ATGTGCAGAGATGGTGGAGCTGG + Intergenic
959698654 3:109276725-109276747 ATGACCATAAATGTTGAAGTAGG - Intergenic
961023943 3:123535657-123535679 CTGAACAGCAATGGTGAAGTGGG + Intronic
961159703 3:124713359-124713381 AAGACTAGGAATGGAGAAGCTGG + Intronic
962143787 3:132818911-132818933 ATGACCAGGCATTGTGGAGCAGG - Intergenic
962301563 3:134248282-134248304 ATGCCCAGAAATGCTGTTGCTGG - Intronic
962462308 3:135625627-135625649 CTGACTATAAATGGGGAAGCAGG - Intergenic
966443676 3:179976317-179976339 AGGAACAGAAGTGGTGAAGATGG + Intronic
967064432 3:185902304-185902326 ATATCCCTAAATGGTGAAGCTGG - Intergenic
968419459 4:471230-471252 ATGACCAGAAGTGGTATTGCTGG - Intronic
970405338 4:15757569-15757591 ATGGAAAGAAATGGTGAAGAGGG - Intergenic
973178061 4:47232660-47232682 ATGCACAGAAATGGATAAGCAGG - Intronic
975496697 4:75043553-75043575 ATTACCATACAAGGTGAAGCAGG + Intronic
978274540 4:106934127-106934149 ATGCCCAGAAATTGTGTAACAGG + Intronic
978885302 4:113761242-113761264 ATGACCAGAAAGGGTGGCGTGGG + Intronic
979243966 4:118477190-118477212 ATAATCAGAAGTGGGGAAGCCGG - Intergenic
979976293 4:127200350-127200372 ATGCCCAGTAGTGGTGTAGCAGG - Intergenic
983584859 4:169343702-169343724 ATGAGGAGAAATCGGGAAGCTGG - Intergenic
986475588 5:8127778-8127800 TTGAACAGAAGTGGTGAAGTTGG + Intergenic
990634172 5:57705398-57705420 AGGAGAAGAAATGGTGAAGGTGG + Intergenic
992102072 5:73417741-73417763 ATGACCAGAAATCAAGATGCCGG + Intergenic
993002114 5:82391704-82391726 ATGGCCAGAAATGGAGAATGAGG + Intergenic
993505714 5:88706487-88706509 ATGCCCAGAAATGGTCAGGGTGG + Intergenic
994255578 5:97590635-97590657 ATGAACAGAAGTGGTGAACATGG + Intergenic
995762072 5:115573954-115573976 ATGACTAGTAATGTTGAAGATGG - Intergenic
998042142 5:138957645-138957667 ATGTCCACAATTGGTGAATCTGG - Intronic
998506944 5:142679684-142679706 ATGAACAGAAAGAGTGAAGAGGG - Intronic
999686273 5:154106033-154106055 ATCCCCTGAAATGGTGTAGCAGG - Intronic
1001817940 5:174686544-174686566 ATGACTGAAAATGGGGAAGCAGG - Intergenic
1004001414 6:11600339-11600361 AAGACCAAAAAGGGTAAAGCAGG + Intergenic
1005981541 6:30840629-30840651 ATGACCAGGAAAAGTTAAGCAGG + Intergenic
1006527927 6:34624130-34624152 TTCACCAGAATTGGTGAAGGAGG - Intronic
1011052241 6:83165351-83165373 TTGACCAGAGATGATGAAGTAGG + Intronic
1011220305 6:85048181-85048203 ATGAGCAAAAATGGGGAGGCTGG - Intergenic
1011364373 6:86565066-86565088 ATGAATAGAAATGGTGAAAATGG + Intergenic
1012379312 6:98601028-98601050 AAGACCAAAAATGCTAAAGCAGG + Intergenic
1014524531 6:122486227-122486249 ACAACCAGAAATGATGAAACTGG - Intronic
1016235281 6:141856638-141856660 ATGAGCAGAAATTGTCAAGTTGG - Intergenic
1017689591 6:156950361-156950383 AAGACCAAAGATGGTGAATCAGG + Intronic
1020622775 7:10537859-10537881 ATGAGCAGAACTGGGGAGGCTGG - Intergenic
1020657993 7:10950369-10950391 ATGGACACAAATGGTGAGGCTGG + Intergenic
1020774546 7:12436422-12436444 ATGAAGAGAAATGTTGAAGTGGG - Intergenic
1021691094 7:23231487-23231509 ATGACCAAAAAAGGTGAAAAGGG - Intergenic
1023927047 7:44676979-44677001 ATGACCAGAAATGGTGAAGCAGG - Intronic
1026399769 7:69997784-69997806 ATGACAACCAATGTTGAAGCTGG - Intronic
1026568923 7:71512538-71512560 ATGAGCAGAAATGTTCAAGACGG + Intronic
1027685702 7:81277228-81277250 ATGGACAGAAATGGAGAAGAAGG - Intergenic
1028400325 7:90418603-90418625 ATGGCCAGCAAAGGTGAAGATGG - Intronic
1029366677 7:100120834-100120856 ATGACAAGCTGTGGTGAAGCTGG - Intronic
1031205014 7:118745229-118745251 ATAACCTGAAATGTTAAAGCAGG + Intergenic
1031219506 7:118946309-118946331 ATGACCGGTAGTGGTGAAACGGG - Intergenic
1031792547 7:126126273-126126295 TTGAATAGAAATGGTGAAGGTGG - Intergenic
1032753611 7:134866882-134866904 ACTACCAGAAAGGGGGAAGCGGG - Intronic
1032934835 7:136716940-136716962 AACACCTGAAATGGTGAAGGTGG - Intergenic
1036633756 8:10533255-10533277 AAGATCAGAAATAGTTAAGCAGG - Intronic
1037364224 8:18105206-18105228 ATGACCAGAAATGGGATTGCTGG + Intergenic
1037785781 8:21902293-21902315 ATGCCCAGGAATGGGGGAGCCGG - Intergenic
1038770726 8:30477008-30477030 ACTGCCAGAAATGGTTAAGCAGG - Intronic
1041167508 8:55103593-55103615 ATCACTAAAAATGGGGAAGCGGG - Intronic
1042427812 8:68669379-68669401 AAGAACAAAAATGGTTAAGCAGG + Intronic
1044668723 8:94657023-94657045 ATGACCACCACTGGTGAAACAGG - Intronic
1047220443 8:122914346-122914368 GTAACCACAAATGGTGAAGTGGG + Intronic
1047695713 8:127401653-127401675 ATGAACTGAAATGGTGCTGCTGG - Intergenic
1048622048 8:136144433-136144455 TTGACCTGAAGTGATGAAGCAGG + Intergenic
1049321283 8:141997893-141997915 AGGAGCAGACATGGGGAAGCGGG - Intergenic
1050500365 9:6292029-6292051 ATGACAAGAAATGGGGAAGAAGG + Intergenic
1055101598 9:72471245-72471267 ATGACCAGAATTGGTAAAATTGG - Intergenic
1055798353 9:80001475-80001497 ATCTCTAGAAATTGTGAAGCAGG + Intergenic
1057815677 9:98292335-98292357 AAAACCAGAACTGGGGAAGCTGG + Intronic
1059252663 9:112900547-112900569 GTGACCAGAAATGTTCAAGATGG - Intergenic
1060210947 9:121710057-121710079 ATGGCCAGAAATGGCAGAGCTGG + Intronic
1061864933 9:133487331-133487353 ATGACCAGGAATGGGAAGGCTGG + Intergenic
1062195806 9:135273345-135273367 AGGACCAGCAATGGTGACACAGG + Intergenic
1186101060 X:6157201-6157223 AAGAACAGAAATGGTGAGGGAGG - Intronic
1187237293 X:17479413-17479435 ATAACCAGTAATGGTGTTGCTGG + Intronic
1188257031 X:27975471-27975493 ATGACCAGAAATGTCGAAAGTGG + Intergenic
1189699954 X:43708302-43708324 ATGACCTAAGAGGGTGAAGCAGG - Intronic
1189720033 X:43906363-43906385 ATGACTAGAAATGATGGAGATGG + Intergenic
1189996292 X:46642028-46642050 TAGCCCAGAAATGGTGAAGCTGG + Intronic
1191729625 X:64319143-64319165 ATCACCAAAAATGGTGGAGTAGG + Intronic
1192441194 X:71175484-71175506 ATCACCAGAAATATTCAAGCAGG + Intergenic
1193042802 X:77021530-77021552 ATGACCAGAAATGTTAAATCAGG - Intergenic
1196001208 X:110788292-110788314 ATCACAAGGAATGGTGAAGATGG - Intronic
1197181572 X:123542337-123542359 GTGATTAGAAAGGGTGAAGCAGG - Intergenic
1198265908 X:135008559-135008581 AAGTCCAGAAATGGTGGATCTGG - Intergenic
1198451963 X:136775650-136775672 TTGAACAGAAATGGTGAAAGGGG - Intronic
1199217251 X:145274312-145274334 AGGAACAGTATTGGTGAAGCTGG - Intergenic
1202277761 Y:23143045-23143067 GTGACCTGAAATGGTGAACTTGG + Exonic
1202278958 Y:23157604-23157626 GTGACCTGAAATGGTGAACTTGG + Exonic
1202279417 Y:23164774-23164796 GTGACCTGAAATGCTGAATCGGG + Exonic
1202285015 Y:23232056-23232078 GTGACCTGAAATGCTGAATCGGG - Exonic
1202285476 Y:23239225-23239247 GTGACCTGAAATGGTGAACTTGG - Intronic
1202285779 Y:23244005-23244027 GTGACCTGAAATGGTGAACTTGG - Exonic
1202287442 Y:23265722-23265744 GTGACCTGAAATGGTGAACTTGG - Exonic
1202287607 Y:23268106-23268128 GTGACCTGAAATGGTGAACTTGG - Exonic
1202287772 Y:23270491-23270513 GTGACCTGAAATGGTGAACTTGG - Exonic
1202287936 Y:23272875-23272897 GTGACCTGAAATGGTGAACTTGG - Exonic
1202288101 Y:23275259-23275281 GTGACCTGAAATGGTGAACTTGG - Exonic
1202288266 Y:23277643-23277665 GTGACCTGAAATGGTGAACTTGG - Exonic
1202432549 Y:24800847-24800869 GTGACCTGAAATGCTGAATCGGG + Exonic
1202437417 Y:24857291-24857313 GTGACCTGAAATGCTGAATCGGG - Exonic
1202437879 Y:24864461-24864483 GTGACCTGAAATGGTGAACTTGG - Exonic
1202439382 Y:24883779-24883801 GTGACCTGAAATGGTGAACTTGG - Exonic
1202439546 Y:24886164-24886186 GTGACCTGAAATGGTGAACTTGG - Exonic
1202439711 Y:24888549-24888571 GTGACCTGAAATGGTGAACTTGG - Exonic
1202439876 Y:24890933-24890955 GTGACCTGAAATGGTGAACTTGG - Exonic
1202440041 Y:24893318-24893340 GTGACCTGAAATGGTGAACTTGG - Exonic