ID: 1023927051

View in Genome Browser
Species Human (GRCh38)
Location 7:44676996-44677018
Sequence GGTCATGTGACTGAGTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023927047_1023927051 -6 Left 1023927047 7:44676979-44677001 CCTGCTTCACCATTTCTGGTCAT 0: 1
1: 0
2: 0
3: 10
4: 236
Right 1023927051 7:44676996-44677018 GGTCATGTGACTGAGTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023927051 Original CRISPR GGTCATGTGACTGAGTGTTG GGG Intronic
No off target data available for this crispr