ID: 1023935574

View in Genome Browser
Species Human (GRCh38)
Location 7:44737570-44737592
Sequence CTGGCCCACAGGAAGTTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023935558_1023935574 27 Left 1023935558 7:44737520-44737542 CCCCTTCTCTCCTCCCTGCCCAC No data
Right 1023935574 7:44737570-44737592 CTGGCCCACAGGAAGTTCTGGGG No data
1023935560_1023935574 25 Left 1023935560 7:44737522-44737544 CCTTCTCTCCTCCCTGCCCACCT No data
Right 1023935574 7:44737570-44737592 CTGGCCCACAGGAAGTTCTGGGG No data
1023935562_1023935574 14 Left 1023935562 7:44737533-44737555 CCCTGCCCACCTGCACCAACTTA No data
Right 1023935574 7:44737570-44737592 CTGGCCCACAGGAAGTTCTGGGG No data
1023935561_1023935574 17 Left 1023935561 7:44737530-44737552 CCTCCCTGCCCACCTGCACCAAC No data
Right 1023935574 7:44737570-44737592 CTGGCCCACAGGAAGTTCTGGGG No data
1023935569_1023935574 -10 Left 1023935569 7:44737557-44737579 CCCATGAGAGCTGCTGGCCCACA No data
Right 1023935574 7:44737570-44737592 CTGGCCCACAGGAAGTTCTGGGG No data
1023935565_1023935574 8 Left 1023935565 7:44737539-44737561 CCACCTGCACCAACTTAGCCCAT No data
Right 1023935574 7:44737570-44737592 CTGGCCCACAGGAAGTTCTGGGG No data
1023935566_1023935574 5 Left 1023935566 7:44737542-44737564 CCTGCACCAACTTAGCCCATGAG No data
Right 1023935574 7:44737570-44737592 CTGGCCCACAGGAAGTTCTGGGG No data
1023935563_1023935574 13 Left 1023935563 7:44737534-44737556 CCTGCCCACCTGCACCAACTTAG No data
Right 1023935574 7:44737570-44737592 CTGGCCCACAGGAAGTTCTGGGG No data
1023935559_1023935574 26 Left 1023935559 7:44737521-44737543 CCCTTCTCTCCTCCCTGCCCACC No data
Right 1023935574 7:44737570-44737592 CTGGCCCACAGGAAGTTCTGGGG No data
1023935567_1023935574 -1 Left 1023935567 7:44737548-44737570 CCAACTTAGCCCATGAGAGCTGC No data
Right 1023935574 7:44737570-44737592 CTGGCCCACAGGAAGTTCTGGGG No data
1023935564_1023935574 9 Left 1023935564 7:44737538-44737560 CCCACCTGCACCAACTTAGCCCA No data
Right 1023935574 7:44737570-44737592 CTGGCCCACAGGAAGTTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023935574 Original CRISPR CTGGCCCACAGGAAGTTCTG GGG Intergenic
No off target data available for this crispr