ID: 1023935703

View in Genome Browser
Species Human (GRCh38)
Location 7:44738299-44738321
Sequence GTGTTTATACAGATGGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023935703_1023935712 16 Left 1023935703 7:44738299-44738321 CCCAGTTCCATCTGTATAAACAC No data
Right 1023935712 7:44738338-44738360 TGCTGCTGGAATGTTGTATGTGG No data
1023935703_1023935710 2 Left 1023935703 7:44738299-44738321 CCCAGTTCCATCTGTATAAACAC No data
Right 1023935710 7:44738324-44738346 GCAGTGGGGGCCAGTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023935703 Original CRISPR GTGTTTATACAGATGGAACT GGG (reversed) Intergenic
No off target data available for this crispr