ID: 1023937453

View in Genome Browser
Species Human (GRCh38)
Location 7:44749528-44749550
Sequence CCCCATCAAAACTGGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023937453_1023937462 13 Left 1023937453 7:44749528-44749550 CCCAGCTGCCAGTTTTGATGGGG 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1023937462 7:44749564-44749586 AACTGGACATACTGAAGCTCAGG 0: 1
1: 0
2: 1
3: 18
4: 126
1023937453_1023937457 -4 Left 1023937453 7:44749528-44749550 CCCAGCTGCCAGTTTTGATGGGG 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1023937457 7:44749547-44749569 GGGGACACCCCTTTCCAAACTGG 0: 1
1: 0
2: 1
3: 13
4: 126
1023937453_1023937463 20 Left 1023937453 7:44749528-44749550 CCCAGCTGCCAGTTTTGATGGGG 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1023937463 7:44749571-44749593 CATACTGAAGCTCAGGCGTGAGG 0: 1
1: 0
2: 0
3: 2
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023937453 Original CRISPR CCCCATCAAAACTGGCAGCT GGG (reversed) Intronic
903647594 1:24904508-24904530 CCAGATGAAAACTGGCAGCCAGG - Intronic
904811343 1:33165252-33165274 CCCCATCATGACTGGCGGCAAGG - Intronic
905642646 1:39601906-39601928 ACCAATCAACACTCGCAGCTAGG - Intergenic
913613078 1:120527598-120527620 CACCATCAAAAATGGTAGGTAGG + Intergenic
914578108 1:148994651-148994673 CACCATCAAAAATGGTAGGTAGG - Intronic
916760153 1:167808576-167808598 CCCCTTCAAAACTGTCATCCTGG - Intergenic
916961022 1:169890050-169890072 CCCCAGCAGTACTGGCAGCCTGG + Intronic
920137126 1:203779040-203779062 CTCCATCTTAAATGGCAGCTGGG + Intergenic
920280933 1:204843109-204843131 CACCATAAAAAGTTGCAGCTGGG + Intronic
920307863 1:205030601-205030623 TCCTATGAAAGCTGGCAGCTAGG + Intergenic
922218350 1:223539110-223539132 GCCCATCACAACTGGCAGACAGG - Intronic
1072484365 10:95840979-95841001 CCCCATCAATACTGACACTTTGG + Intronic
1074075708 10:110122227-110122249 TCCCATCAAAAATGGAAGGTTGG + Exonic
1075089080 10:119433164-119433186 CCCCGACAAGGCTGGCAGCTGGG - Intronic
1078899602 11:15629260-15629282 CCCCTTGAAGACTGGCATCTTGG - Intergenic
1080456757 11:32426395-32426417 CCCTAGCAAAACTGGCAGCGGGG - Intronic
1084507128 11:69575182-69575204 CCCTATCAAGACTGACAGCCTGG + Intergenic
1084973897 11:72785914-72785936 CTCCATCAAAACTGGCAGGCAGG - Intronic
1086741332 11:90373115-90373137 CACCATCACAACTGGCTTCTTGG + Intergenic
1087422183 11:97943483-97943505 CACCAAAAACACTGGCAGCTTGG + Intergenic
1089159129 11:116424223-116424245 CTCCTTAAAAGCTGGCAGCTGGG + Intergenic
1090003413 11:122980745-122980767 CTCCAGCAATGCTGGCAGCTGGG + Intronic
1090263599 11:125340312-125340334 CCAACTCTAAACTGGCAGCTTGG + Intronic
1092137553 12:6160212-6160234 CCCCGTCAAAACAGGCCACTCGG + Intergenic
1092405899 12:8222052-8222074 CCCCATCATGGCTGGCCGCTGGG + Exonic
1096403110 12:51323835-51323857 TTCCATGAAAACTGGCAGATTGG - Intronic
1100446586 12:94666322-94666344 ACCTTTCAAAACTGTCAGCTAGG - Intergenic
1100666301 12:96757021-96757043 CACTATCAAATCTGTCAGCTGGG - Intronic
1103845582 12:123899938-123899960 CAGCATCAAAACAGGCAGCAGGG - Intronic
1104111385 12:125708049-125708071 ACCAATTAAAAATGGCAGCTGGG + Intergenic
1104747289 12:131218705-131218727 CTCCATCCACCCTGGCAGCTTGG + Intergenic
1105038879 12:132946558-132946580 CCCCTTGGAAACCGGCAGCTGGG - Intronic
1107663041 13:42659009-42659031 CCCCATCTAGACTGGCAACGAGG - Intergenic
1111342944 13:86912552-86912574 CTCCCTCCACACTGGCAGCTAGG - Intergenic
1113091354 13:106619911-106619933 CCCCATAAGTAATGGCAGCTTGG - Intergenic
1119002158 14:70892284-70892306 CCCCCTCAGAACTGGTAGCTGGG + Intergenic
1119546723 14:75477341-75477363 CCCACTCAAAACTGGCAGGTTGG - Intergenic
1121802585 14:96786875-96786897 CCTCATGAAAACTGGCCGGTGGG + Intergenic
1127295567 15:57605835-57605857 GCCCATTCAAACTGGCTGCTAGG - Intronic
1128595934 15:68949269-68949291 CCTAATCAAAAATGGGAGCTGGG - Intronic
1128742962 15:70096236-70096258 CCCCATCAACCCGGGCAGCCGGG - Exonic
1129089759 15:73136851-73136873 CCCCCTCAAAACTCCCAGATTGG + Intronic
1129880602 15:79003994-79004016 CCCCATCATCACTGGCGGCAAGG - Exonic
1137270931 16:46901839-46901861 CCCCATCCAGGCTGGCAGGTGGG - Intronic
1141339118 16:83186857-83186879 CCCCATTGAAGCAGGCAGCTGGG + Intronic
1141656589 16:85419965-85419987 ACCCATGATAACTGCCAGCTGGG - Intergenic
1142031883 16:87842620-87842642 CCCCAGCACACCTGGCATCTGGG - Intronic
1146838112 17:36128517-36128539 CCCCATCAAAATTGCCAGGAAGG - Intergenic
1147198017 17:38780562-38780584 CCCCATCAACAGTGACAGCCAGG - Exonic
1149165867 17:53751102-53751124 CCCCATCAAAACGTGCACCAAGG - Intergenic
1152530197 17:80914242-80914264 CCCCTTCCAAACTGGCAGGGTGG + Intronic
1153452683 18:5247459-5247481 CCCCAACAGTACTGGCATCTAGG - Intergenic
1156438433 18:37158681-37158703 CTCCATCACAACTGGAAACTTGG - Intronic
1157084616 18:44566793-44566815 CCCCTTCATAAATGACAGCTTGG - Intergenic
1159094344 18:63885586-63885608 CCCCTACAAGACTGGCAGCTAGG + Intronic
1160162316 18:76483156-76483178 CTCCAGCAAAGCAGGCAGCTGGG - Intronic
1162962379 19:14135947-14135969 CCCCATGAAAACGGGTACCTAGG + Intronic
1163270225 19:16248583-16248605 CCCCAGCACAGATGGCAGCTGGG - Intergenic
1164312903 19:24061702-24061724 CACCATCAAACCTGTGAGCTGGG - Intronic
1165412074 19:35668225-35668247 CCCCGAAGAAACTGGCAGCTGGG + Intronic
1166108672 19:40610072-40610094 CCCGATAGAAACTGGCAGTTTGG - Intronic
1168494703 19:56839258-56839280 CCCCATCAAACATGGCATCTAGG + Intronic
925382872 2:3438605-3438627 CCCCATCACCCCTGGGAGCTTGG + Intronic
926367366 2:12145620-12145642 CCCCATCCAAACTGTCAGTCAGG + Intergenic
929583367 2:43098682-43098704 CCCCATCAACACAGGCAGTGGGG - Intergenic
932902180 2:75712472-75712494 CCCTGTCAAAACAGGCCGCTGGG + Intergenic
933476073 2:82792480-82792502 CCATACCCAAACTGGCAGCTGGG - Intergenic
935770575 2:106415807-106415829 CACCATAAAAACTGCCAGTTTGG - Intronic
936786906 2:116104302-116104324 CCTCATTAAAAGTGGGAGCTGGG - Intergenic
938249721 2:129805280-129805302 CCTCATCCAAACTGGCAGTGGGG + Intergenic
939248565 2:139657618-139657640 GCCCATCCAAACTGGCAGATAGG + Intergenic
940666584 2:156617656-156617678 CCCTATCAAAACAGGCCACTCGG - Intergenic
943723867 2:191232974-191232996 CACCATCAAAACAGGCAGAGAGG - Intergenic
944389132 2:199199310-199199332 CCCCATCAATACTGCCACATTGG - Intergenic
1169218103 20:3804889-3804911 CCGCCTCAAGACTCGCAGCTGGG + Exonic
1169357087 20:4916130-4916152 ACCTATAAAAACTGGCTGCTGGG + Intronic
1171217137 20:23360892-23360914 CCCCATTAAAACTGGGAGACAGG + Intergenic
1171318721 20:24220225-24220247 CCCTGTCAAAACAGGCCGCTCGG - Intergenic
1176021793 20:62965995-62966017 CTCCATGAAGACGGGCAGCTGGG + Intronic
1179776013 21:43663142-43663164 CCCCATCTAAAATGGCTTCTGGG + Intronic
1179829156 21:43985154-43985176 CCCCATGACACCTGGCACCTGGG - Exonic
1184191113 22:42895118-42895140 CCCCAGCAAGGCTGGCAGCTCGG + Intronic
1184417735 22:44361985-44362007 CCCCAGTAAAACTGCCAGCCAGG - Intergenic
951701710 3:25503487-25503509 CTCTGTAAAAACTGGCAGCTTGG + Intronic
952998125 3:38904967-38904989 CCCACTCTAAACTGGCACCTGGG - Intronic
953060197 3:39421513-39421535 CCCCATCAATGGTGACAGCTAGG + Intergenic
956538273 3:70304400-70304422 CCCCATGGAAACTGTCAACTGGG - Intergenic
960724137 3:120653394-120653416 CTCCATGAAACGTGGCAGCTGGG - Intronic
962471358 3:135712073-135712095 CCCCATCAACCCTTGTAGCTGGG - Intergenic
963068005 3:141279198-141279220 CCCCATCCAGAATGGCAGCCAGG + Intronic
963327904 3:143882017-143882039 ACCCATGAAAACTGGCTCCTGGG - Intergenic
967709007 3:192684251-192684273 CCCCGTTAACACAGGCAGCTTGG - Intronic
974472493 4:62336887-62336909 CCCTATCAAAACTGCCACATTGG - Intergenic
975744777 4:77465385-77465407 CCCCATCCACTCTGCCAGCTAGG - Intergenic
981822266 4:148899725-148899747 CCCCTTCAAAAGTGGCACCTGGG - Intergenic
982697917 4:158624612-158624634 CTCCATTAAAGCTTGCAGCTAGG + Intronic
983484529 4:168318323-168318345 CCCCGTCAAAGGTGGGAGCTGGG - Intronic
987119853 5:14756773-14756795 CCCCCTCACCCCTGGCAGCTTGG - Intronic
992069363 5:73135514-73135536 CCCCATGAGCACTGGCGGCTGGG - Intergenic
997384883 5:133464741-133464763 CCCGATCAAATCCTGCAGCTGGG - Intronic
999930737 5:156431036-156431058 CCTCATCAAGACTGGGATCTTGG - Intronic
1001096957 5:168782767-168782789 CCTCCTTAAAACTGGCTGCTAGG - Intronic
1004224507 6:13773230-13773252 CCCTATCAAAACAGACTGCTCGG + Intergenic
1006786126 6:36668586-36668608 CTCCATCAAAGCTGGGAGCATGG - Intergenic
1008130339 6:47713860-47713882 TCCCAACAAAAATGCCAGCTCGG + Exonic
1008540793 6:52545203-52545225 CCCCATCTGAACTCACAGCTGGG + Intronic
1009926914 6:70130928-70130950 CCCCACCAAAAATGGCTGCCAGG - Intronic
1012189206 6:96260446-96260468 CCCTGTCAAAACAGGCCGCTGGG - Intergenic
1015308167 6:131733804-131733826 CCCCACCAAAACTACCTGCTTGG + Intronic
1018545806 6:164934198-164934220 CCCTATCAAAACAGGCCACTCGG + Intergenic
1018881200 6:167882971-167882993 CCCCATCCAGACTGTCAGCCAGG + Intronic
1019649979 7:2151632-2151654 ACCCAGCAAAGCTGGGAGCTGGG + Intronic
1023937453 7:44749528-44749550 CCCCATCAAAACTGGCAGCTGGG - Intronic
1024083764 7:45876929-45876951 CCATACCCAAACTGGCAGCTTGG - Intergenic
1024523958 7:50332442-50332464 CCCCATGAAATCAGGCAGCAGGG + Intronic
1029458720 7:100683712-100683734 CCCCAGCCAGAATGGCAGCTAGG + Intronic
1029852342 7:103476167-103476189 TCACATTAAAAATGGCAGCTGGG + Intronic
1031050837 7:116943835-116943857 CTCCAGCAAAACTGGGAGGTAGG - Intergenic
1031465558 7:122106277-122106299 CCCCTTGAAAACTGGCAACAAGG - Intronic
1036082219 8:5569211-5569233 CCCCAGCGAAACAGGCTGCTTGG + Intergenic
1036263852 8:7259662-7259684 CCCCATCATGGCTGGCCGCTGGG - Intergenic
1036267755 8:7282528-7282550 CCCCATCATGGCTGGCCGCTGGG - Intergenic
1036269058 8:7290150-7290172 CCCCATCATGGCTGGCCGCTGGG - Intergenic
1036270352 8:7297772-7297794 CCCCATCATGGCTGGCCGCTGGG - Intergenic
1036302743 8:7579874-7579896 CCCCATCATGGCTGGCCGCTGGG + Intergenic
1036315892 8:7718201-7718223 CCCCATCATGGCTGGCCGCTGGG - Intergenic
1036846284 8:12172991-12173013 CCCCATCATGGCTGGCCGCTGGG + Intergenic
1036867647 8:12415310-12415332 CCCCATCATGGCTGGCCGCTGGG + Intergenic
1037456476 8:19069019-19069041 CCCCATCAGAACTGTGAGTTGGG - Intronic
1037585739 8:20274819-20274841 CCCCACCTAAACTGGAAGTTAGG + Intronic
1040351387 8:46572264-46572286 CCCTATCAAAACAGACCGCTAGG + Intergenic
1055425782 9:76194954-76194976 CCCCATCCAAACAGCAAGCTAGG + Intronic
1057522385 9:95770400-95770422 CACCAGACAAACTGGCAGCTTGG - Intergenic
1057809406 9:98246416-98246438 CTCCATCAGATCTGGCAGGTAGG + Intronic
1057949730 9:99360170-99360192 CTTCATCCAAACTGGCAGATGGG - Intergenic
1059637741 9:116187332-116187354 GCCCATCATAGGTGGCAGCTAGG - Exonic
1059651428 9:116319334-116319356 CCTCCTCAAAACGGGCATCTGGG + Intronic
1060228160 9:121808758-121808780 CCCCATCCAAATTGTAAGCTTGG + Intergenic
1189891745 X:45610267-45610289 CACCATCAGCACTGGCAGCATGG + Intergenic
1194649394 X:96497632-96497654 CACACTCAAAACTAGCAGCTGGG - Intergenic