ID: 1023939631

View in Genome Browser
Species Human (GRCh38)
Location 7:44761335-44761357
Sequence CCCCGCAGGGACCTTGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023939631_1023939639 -10 Left 1023939631 7:44761335-44761357 CCTTCACCAAGGTCCCTGCGGGG 0: 1
1: 0
2: 2
3: 12
4: 165
Right 1023939639 7:44761348-44761370 CCCTGCGGGGAAGGTGGCTGGGG 0: 1
1: 0
2: 12
3: 35
4: 399
1023939631_1023939645 27 Left 1023939631 7:44761335-44761357 CCTTCACCAAGGTCCCTGCGGGG 0: 1
1: 0
2: 2
3: 12
4: 165
Right 1023939645 7:44761385-44761407 TTGAGTGACACAAGACGCTCTGG 0: 1
1: 0
2: 1
3: 1
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023939631 Original CRISPR CCCCGCAGGGACCTTGGTGA AGG (reversed) Intronic
900334322 1:2154069-2154091 CCCCGCAGGGACGTCGGCGTTGG - Intronic
900461199 1:2802780-2802802 CCCCGCAGGCCCTTTGGGGAGGG + Intergenic
900506218 1:3030890-3030912 CCTCGCTGGGGCCTGGGTGAGGG - Intergenic
902333896 1:15744061-15744083 GCCTGAAGGGACCTTGGGGATGG - Intronic
903141781 1:21343657-21343679 CCCCACAGGGACTTTGGTCTAGG - Intronic
906526493 1:46496271-46496293 GCCTGCAGGGTCCTTGGTCAGGG + Intergenic
907407706 1:54263748-54263770 CCCCACAGGTACCTTGGGGCAGG + Intronic
908592655 1:65650627-65650649 CCCAGCTGGGACCTTGAAGATGG - Intergenic
911215418 1:95187834-95187856 CCCTGCAGGCACCTTGGTCTTGG - Intronic
912549072 1:110472836-110472858 CCCAGCAGGCACCGTGGAGATGG - Intergenic
914239988 1:145846797-145846819 CACAGCAGGGACATGGGTGAGGG - Intronic
915554293 1:156652807-156652829 CCCAGCAGGGACCTCAGTGCAGG + Exonic
918188548 1:182149147-182149169 CCAGGCAGTGACCTTGGAGAGGG + Intergenic
919214515 1:194534969-194534991 TCTCGCAGGGTCCTTGGGGAGGG - Intergenic
919883442 1:201915864-201915886 AGCCCCAGGGACCTTGCTGAAGG + Intronic
919974336 1:202600878-202600900 TCCCCCAGGGCCCTTGGTGGTGG - Intronic
922042557 1:221910968-221910990 TCCCACAGGGACCTTGGTGATGG - Intergenic
922109561 1:222543833-222543855 CCCAGCATGGACCATGGAGACGG + Exonic
922582742 1:226710800-226710822 CCCATCAGGGGCCTGGGTGAAGG - Intronic
1066180627 10:32958035-32958057 CCGCGCCGGGACCTTTGTGCCGG - Intronic
1067569416 10:47360566-47360588 CCAGGCAGGGACCTTGGAGGTGG - Intergenic
1068762961 10:60733207-60733229 CCCCGCATGCCCCTGGGTGAAGG + Intronic
1070915958 10:80154831-80154853 CCCTCCTGGGACCTGGGTGAAGG + Exonic
1071524056 10:86347966-86347988 CCCCACTGGGACCATGGGGAAGG - Intronic
1074333322 10:112542576-112542598 ACACGCAGGGCCCTGGGTGAAGG - Intronic
1075788315 10:125065459-125065481 GCCCGCAGGGGCTTTGGGGAAGG + Intronic
1076258897 10:129050441-129050463 CCCCACAGGAGCCCTGGTGAGGG - Intergenic
1076378807 10:130011194-130011216 AGCAGCAGGGGCCTTGGTGATGG - Intergenic
1076483665 10:130801873-130801895 CTGTGCAGGGACCCTGGTGAAGG - Intergenic
1076805489 10:132856133-132856155 CAGCGCAGGGACCTCTGTGAAGG - Intronic
1076824179 10:132959001-132959023 CTCTGCAGGGACCTTGGCCACGG - Intergenic
1077213198 11:1382959-1382981 CCACACAGCCACCTTGGTGAGGG + Intergenic
1079603277 11:22337656-22337678 CCCCGTATGGTCCTTGGTCAGGG + Intergenic
1081991325 11:47339182-47339204 CCCCACAGGGACCCTGCTGGGGG + Intronic
1082002279 11:47399951-47399973 CCCCACAGGGCTGTTGGTGATGG - Intergenic
1082634839 11:55583440-55583462 ACCTGCAGGGACCCTGATGATGG - Intergenic
1083274332 11:61588170-61588192 TCCCCCAGAGGCCTTGGTGAGGG - Intergenic
1083656112 11:64230559-64230581 CCACCCAGGGAACTTGGGGACGG - Exonic
1084062946 11:66687633-66687655 CCCCCCAGGGACCTGGCTCAGGG - Exonic
1084714998 11:70868052-70868074 CAGCGCCGGGCCCTTGGTGACGG - Intronic
1085387107 11:76163714-76163736 CCCGCCAGGGGCCTTGGTGAGGG - Intergenic
1089367375 11:117929298-117929320 CCCCTCAGAGACCATGGAGAGGG - Exonic
1100178812 12:92061245-92061267 TCCCTCAGGGACCTTGTTGCTGG - Intronic
1102012563 12:109627655-109627677 CCCTGGAAGGGCCTTGGTGAGGG - Intergenic
1102060056 12:109925204-109925226 CCCAGCAGGGGCCTGGGTGTGGG + Intronic
1111826027 13:93268872-93268894 CACAGCAGGGAACTTGTTGAAGG - Intronic
1114195030 14:20469552-20469574 GCCCGCAGGACCCTTGGGGAGGG + Intronic
1118770206 14:68937864-68937886 ACCAGCAGGGTCCTTGGAGAAGG + Intronic
1119783986 14:77298757-77298779 CCCCACAGTGGCCCTGGTGACGG - Exonic
1122076523 14:99238497-99238519 CCTCACAGGGGCCTTGGTGTTGG - Intronic
1122445141 14:101762151-101762173 GGCCGCTGGGACCTTCGTGATGG + Intronic
1122540969 14:102497461-102497483 CCCCGCAGGGACCCTGGTGGAGG + Intronic
1122628993 14:103098939-103098961 CCCAGCAGGCACCTTGCTGGAGG + Intergenic
1122862834 14:104590179-104590201 CCCAGAAGGGACCATGGTGGGGG + Intronic
1123067746 14:105626939-105626961 CCCAGCAGGGACCTTGCCGGGGG - Intergenic
1123071765 14:105645664-105645686 CCCAGCAGGGACCTTGCCGGGGG - Intergenic
1123091429 14:105743940-105743962 CCCAGCAGGGACCTTGCCGGGGG - Intergenic
1123097199 14:105772281-105772303 CCCAGCAGGGACCTTGCCGGGGG - Intergenic
1123418286 15:20108298-20108320 CCCCGCAGGAAGCATGGTGCAGG - Intergenic
1123527504 15:21114820-21114842 CCCCGCAGGAAGCATGGTGCAGG - Intergenic
1123991697 15:25688302-25688324 CCCCCCAGAAGCCTTGGTGATGG + Intronic
1126793865 15:52244119-52244141 CCCTGCAGGGCCCTGGGTGTCGG + Intronic
1127358724 15:58226465-58226487 CCACAGAGGGACCTTGGGGAGGG - Intronic
1127760210 15:62132076-62132098 CCCTGCAGGAACTTTGGTGGTGG + Intergenic
1127996722 15:64157221-64157243 CCACGGAGGGACTTTGGTGGAGG + Exonic
1128812004 15:70579753-70579775 CCCCACTAGGACCTTGGTGGTGG + Intergenic
1129781365 15:78274134-78274156 CCCAGCAGGGACACTGGTAAGGG + Intronic
1130718532 15:86362838-86362860 CCACCCAGGGAACTGGGTGAAGG - Intronic
1130974183 15:88760251-88760273 CACCCCAGCAACCTTGGTGAAGG - Intergenic
1131387331 15:92018333-92018355 GCCAGCAGGGGCCCTGGTGATGG + Intronic
1131870462 15:96758366-96758388 CGACTCAGGGACATTGGTGAGGG - Intergenic
1132517911 16:374458-374480 CTCTGCAGGGTCCTGGGTGAGGG - Intronic
1132654648 16:1036720-1036742 CCCCCGAGGGGCCTTGGTGGAGG + Intergenic
1136153613 16:28367972-28367994 CCCCGCAGGGCAGTTGGTGAGGG - Intergenic
1136209474 16:28747295-28747317 CCCCGCAGGGCAGTTGGTGAGGG + Intergenic
1136617911 16:31410079-31410101 CACCGTAAGGGCCTTGGTGATGG + Intronic
1137584396 16:49655585-49655607 CCCAGCAGGGATCCTTGTGAGGG - Intronic
1141777164 16:86132025-86132047 CCCTGCAGGGACATTGGCCACGG - Intergenic
1142141643 16:88475301-88475323 ACACACAGGGACCATGGTGAGGG + Intronic
1142411162 16:89917957-89917979 CCCAGCAGGGACGGTGGAGAGGG - Exonic
1142466654 17:140830-140852 CCTGGGGGGGACCTTGGTGAGGG + Intergenic
1142466789 17:141160-141182 CCTGGGGGGGACCTTGGTGAGGG + Intergenic
1142466894 17:141416-141438 CCTGGGGGGGACCTTGGTGAGGG + Intergenic
1142760557 17:2039747-2039769 CCCTGCAGGTATCTTGGAGATGG + Exonic
1147243471 17:39105816-39105838 CCCCGCAGAGGCCTTGATGGGGG - Intronic
1148146870 17:45371671-45371693 ACCCGCTGGGACCTTGGTAGGGG - Intergenic
1149580502 17:57747076-57747098 CACCACAGGGACCGTGATGAGGG + Intergenic
1150626141 17:66842289-66842311 GCCAGCAGGGAACTTGGTTAAGG - Intronic
1151159517 17:72153082-72153104 CCCCTCAGGGACCTTGGGCTGGG + Intergenic
1156298021 18:35810098-35810120 CCCCCAGGGGTCCTTGGTGATGG - Intergenic
1156355903 18:36339643-36339665 CCCAGCAGGGGCCTGGGTGCAGG + Intronic
1160488141 18:79312115-79312137 CCGCGAAGGCACCTTTGTGAAGG - Intronic
1160532852 18:79575704-79575726 CATCTCAGGCACCTTGGTGATGG + Intergenic
1160989884 19:1856154-1856176 CACAGCAGGGACCATGGTGAGGG + Intronic
1161393413 19:4032717-4032739 CCCCGCTGTGGCCTTGGGGATGG + Intronic
1161470087 19:4452889-4452911 GCACGCAGGGACCTTAGAGATGG - Intronic
1161995409 19:7708367-7708389 CCCCCTAGGGACTTTGGTGTGGG + Intergenic
1163020977 19:14480581-14480603 CTCCCCAGGCACCTTGATGAAGG + Exonic
1163615201 19:18323011-18323033 CCCCGCCGGCACCATGGTGAGGG - Exonic
1163779314 19:19238142-19238164 CCCCGCAGTGACCTTGGATTGGG + Intronic
1165461004 19:35944467-35944489 CCCCGCAGGGAGTTTGGTGGGGG + Intronic
1165938149 19:39402141-39402163 CCGCGCAGGTGCCTGGGTGAGGG - Intergenic
1166206634 19:41274120-41274142 CCCAGCAGGGATTCTGGTGAAGG - Intronic
1166379885 19:42350374-42350396 CCCCACAGGCACCTGGGTGCAGG - Exonic
1167592928 19:50414159-50414181 CCACGCAGGGACCCTGATGGGGG + Intronic
927202249 2:20585016-20585038 CCCTGCAGTGACCTTGGGAAAGG + Intronic
927458298 2:23276250-23276272 CTCAGCAGAGACCTGGGTGAGGG - Intergenic
927707850 2:25307895-25307917 CCCTTCAGGGGCCTAGGTGAGGG - Intronic
928312542 2:30222796-30222818 CCACCCAGGGCCCTTGGTGAGGG + Intergenic
929587839 2:43127257-43127279 CCCCGCAGGGACCACGCGGAAGG - Intergenic
929979757 2:46667255-46667277 CCCCTCAGGGCCTTTGGAGAAGG - Intergenic
932564389 2:72896438-72896460 CCCCAGAGGGACCTGGGTGCGGG - Intergenic
937458203 2:122062325-122062347 CATAGCAGTGACCTTGGTGATGG + Intergenic
947070942 2:226287545-226287567 CCCTTCAGGGACCTGGATGATGG - Intergenic
1169022377 20:2339786-2339808 CCCTGCCTGCACCTTGGTGAGGG - Intronic
1169906017 20:10604691-10604713 CCACTCAGGGACTTTGGTGCAGG + Intronic
1170412108 20:16103103-16103125 CCCAGCAGGTACATGGGTGAGGG + Intergenic
1172588500 20:36101490-36101512 GTCAGAAGGGACCTTGGTGAAGG + Intronic
1173144800 20:40515277-40515299 CCCTGCAAGGACCTGGGGGAGGG - Intergenic
1174556232 20:51397519-51397541 CCCCCCAGGGAACTTGTCGAAGG - Intronic
1175145818 20:56895576-56895598 CGCGGCAGGGAGCTTGGTAAAGG - Intergenic
1176063873 20:63184218-63184240 CTCTGCAGGGTCCATGGTGATGG - Intergenic
1176070153 20:63222103-63222125 CCCAGCAGGGACCTGGGTGTGGG - Intergenic
1176235119 20:64050337-64050359 CCCCCAAGGGCCCTTGGGGAAGG + Intronic
1176429608 21:6567713-6567735 CCCCGCAGGCACCAAGCTGACGG + Intergenic
1179917979 21:44490329-44490351 ACCCCCACGGACCTAGGTGAGGG + Intergenic
1180091252 21:45534804-45534826 CCCTGCTGGGACCGTTGTGAGGG - Intronic
1181452410 22:23032572-23032594 CACCGCATGGACCAGGGTGATGG + Intergenic
1181546350 22:23604656-23604678 CCCTGCAGTGGCCGTGGTGAGGG - Intergenic
1184594310 22:45504514-45504536 CCCCGAGGGGCCCTGGGTGATGG + Intronic
1184652923 22:45927302-45927324 CCCCCCAGGGAGCTTGGGGAAGG + Intronic
1185208436 22:49553395-49553417 ACCCGCAGTGACCTTGGGCAGGG + Intronic
1185373451 22:50471280-50471302 GGCCGCAGGGACATTGGTGCAGG - Intronic
1185384618 22:50526127-50526149 CCCCGCAGGCACCGTGGAGCTGG - Exonic
950124067 3:10500916-10500938 CCCCCCAGTGTCCTTGGTGAGGG - Intronic
950466741 3:13160256-13160278 CCAAGCAGGGACCTTGGGGCAGG + Intergenic
950875134 3:16264757-16264779 CCCTGAAGTTACCTTGGTGATGG + Exonic
953019133 3:39102985-39103007 CCCCACAGTGACCCTGCTGAGGG - Intronic
953863398 3:46564202-46564224 TCCTGCAGGGACCTTGAGGAAGG + Intronic
954611077 3:51944895-51944917 GCCCTCATGGACCTGGGTGAGGG + Exonic
955000973 3:54927826-54927848 TCCCGCAGATACCTTTGTGAGGG + Intronic
961330628 3:126135929-126135951 CCCAGCAGGCACCAAGGTGAGGG - Intronic
962859524 3:139386682-139386704 CCAGGCAGGAACCATGGTGAGGG + Intronic
968930584 4:3576602-3576624 CCTCGCAGGGACTTTGGTCTCGG + Intergenic
969173913 4:5384963-5384985 TCCAGCAATGACCTTGGTGATGG - Intronic
984992598 4:185396141-185396163 CCGCGCAGGGACCCTTGTGGAGG - Intronic
988793739 5:34633289-34633311 CCCAGGGGTGACCTTGGTGATGG + Intergenic
991241398 5:64465054-64465076 CTCCGCAGGGACATGGATGAAGG - Intergenic
997638813 5:135435196-135435218 TCCTGCAAGGACCTGGGTGAAGG + Intergenic
1002448863 5:179307804-179307826 CCTCACAAGGACCTTGGTGAAGG + Intronic
1002857638 6:1052276-1052298 TCCTGCAGGGACCTTGTTGTGGG - Intergenic
1006907385 6:37541978-37542000 CCCCCCAGGGACCTGGGATAAGG - Intergenic
1017720165 6:157238290-157238312 CCCCACAGGCACCTTTGAGATGG + Intergenic
1018899599 6:168044446-168044468 ACCCTCCGGGACCTGGGTGAGGG + Intronic
1020040158 7:4995770-4995792 CCCTGCTGAGACCTGGGTGAGGG + Intronic
1023939631 7:44761335-44761357 CCCCGCAGGGACCTTGGTGAAGG - Intronic
1024026577 7:45414415-45414437 CCCAGCTGGGACCTTGGACAGGG + Intergenic
1024061607 7:45702853-45702875 CCCTGCAGGGACCTAGGGCAGGG - Intronic
1024538252 7:50456395-50456417 TCCTGCAGGCTCCTTGGTGATGG + Intronic
1025003882 7:55340711-55340733 CCCTGCTGGGACCCTGGTTAGGG - Intergenic
1029185794 7:98737479-98737501 CACCGTAGGGACCTTTGTGGTGG + Intergenic
1032348180 7:131136140-131136162 CCCTGCAGGGACTTGGGTGTAGG + Intronic
1034910630 7:154995340-154995362 CCCCCCAGGGAGCTTGGGTAGGG + Intronic
1035662987 8:1361210-1361232 TGCCGCAGGGACCATGGTCAGGG - Intergenic
1035749402 8:1985245-1985267 GCCCACACAGACCTTGGTGAGGG + Intronic
1037579160 8:20234576-20234598 CCCCGCTGGGCCCTGGGTGGGGG - Intergenic
1037653956 8:20867109-20867131 CCCAGCAGGGAGCTTGGAGTTGG - Intergenic
1041194711 8:55389199-55389221 CCCTGCAGGCACCTTGGTACTGG + Intronic
1045368087 8:101494106-101494128 CCCCGAGGGGACCTTCCTGAAGG + Intronic
1049805022 8:144534809-144534831 CCCCTCAGGGACCCTGCTGTCGG - Intronic
1051078502 9:13268862-13268884 CCATGCAGGGACATTGGGGAGGG + Intronic
1052589031 9:30466780-30466802 CCCAGCAGGCAAGTTGGTGAGGG + Intergenic
1054808314 9:69413335-69413357 ACCTGCAGGGAGCTTGGGGAAGG - Intergenic
1057927988 9:99170050-99170072 CCCCTCAGTGACCATGATGAGGG - Intergenic
1061192350 9:129089185-129089207 CCCCCCAGGGTCCTGGTTGAGGG - Exonic
1061328119 9:129876228-129876250 CGCCGCACGCACCTTGATGAAGG - Exonic
1200011688 X:153125118-153125140 CCTCGCAGGGCCCCTGGAGATGG + Intergenic
1200012241 X:153127656-153127678 CCTCGCAGGGCGCTTGGTGTAGG + Intergenic
1200027913 X:153274801-153274823 CCTCGCAGGGCCCCTGGAGATGG - Intergenic
1200216808 X:154371698-154371720 CCCCGCAGGGGCCCTGGGGAAGG - Intronic