ID: 1023940754

View in Genome Browser
Species Human (GRCh38)
Location 7:44767207-44767229
Sequence GCTGATGCACAGAGGGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023940742_1023940754 20 Left 1023940742 7:44767164-44767186 CCAGCATTCACCTTGGGGCATCA 0: 1
1: 0
2: 2
3: 7
4: 117
Right 1023940754 7:44767207-44767229 GCTGATGCACAGAGGGAGTGTGG No data
1023940747_1023940754 10 Left 1023940747 7:44767174-44767196 CCTTGGGGCATCACGGTGGGGAT 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1023940754 7:44767207-44767229 GCTGATGCACAGAGGGAGTGTGG No data
1023940738_1023940754 26 Left 1023940738 7:44767158-44767180 CCACCACCAGCATTCACCTTGGG 0: 1
1: 0
2: 2
3: 25
4: 240
Right 1023940754 7:44767207-44767229 GCTGATGCACAGAGGGAGTGTGG No data
1023940741_1023940754 23 Left 1023940741 7:44767161-44767183 CCACCAGCATTCACCTTGGGGCA 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1023940754 7:44767207-44767229 GCTGATGCACAGAGGGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023940754 Original CRISPR GCTGATGCACAGAGGGAGTG TGG Intronic
No off target data available for this crispr