ID: 1023948609

View in Genome Browser
Species Human (GRCh38)
Location 7:44823393-44823415
Sequence AAACCTAACCCCCTATAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 79}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023948609 Original CRISPR AAACCTAACCCCCTATAGAG TGG Intronic
903240803 1:21981362-21981384 AAACCTGTCTCCCTACAGAGGGG + Intronic
903244541 1:22006002-22006024 AAACCTGTCTCCCTACAGAGGGG + Intronic
903627406 1:24741473-24741495 AAACCTGACCCCCTGTGTAGGGG + Intergenic
906194923 1:43924002-43924024 AAACCTAACCCCCAATGTAATGG - Intronic
912309818 1:108609041-108609063 AACCCTAACCCCCAAAAGGGTGG - Intronic
915841936 1:159220301-159220323 AATCCTAACCCCCAATATAATGG - Intergenic
915878347 1:159637567-159637589 AACCCTAACCCCCAATAGGATGG + Intergenic
917787718 1:178476896-178476918 AAAACTAACCCTCTATGGAAGGG - Intronic
920975588 1:210782348-210782370 AACCCTAACTCCCAATACAGTGG + Intronic
1064687501 10:17879067-17879089 AAACCAAACCACCCATGGAGAGG - Intronic
1078664540 11:13313817-13313839 AAAGCTAACCCCCTTCAGCGGGG + Intronic
1083043268 11:59708599-59708621 AAACTTAATCCCCATTAGAGTGG - Intergenic
1084504635 11:69557598-69557620 AAACTAAACCCCCCATATAGAGG - Intergenic
1085371961 11:76016429-76016451 AAACTTAACACACTATACAGTGG - Intronic
1087934259 11:104013599-104013621 AGACCTAACTTCCAATAGAGTGG + Intronic
1088748724 11:112825834-112825856 AGACAAAACCCCCTACAGAGAGG - Intergenic
1088880114 11:113966783-113966805 AAACCTAACCCCCAATGTAATGG + Intergenic
1092932676 12:13331558-13331580 AATCCTAACCCCCAATGCAGTGG - Intergenic
1095388966 12:41682773-41682795 TAACCTAACCCCCTAATGACAGG + Intergenic
1095561980 12:43576024-43576046 AGACCTCACTCCCTACAGAGTGG - Intergenic
1097533829 12:60839788-60839810 AATCCTAACCCCCAATATAATGG + Intergenic
1098346069 12:69504832-69504854 AAGCCTAATCCCCCATAGACAGG + Intronic
1104043327 12:125144755-125144777 AGAACTCACCCCCTACAGAGGGG + Intergenic
1104077982 12:125407337-125407359 AAACCCAAAACCCTGTAGAGTGG + Intronic
1110378884 13:74826808-74826830 AACCCTAACCCCCAACAGAATGG + Intergenic
1110486303 13:76048387-76048409 AATCCTAACCCCCAAGAGAATGG - Intergenic
1128326749 15:66729028-66729050 GAACCAAATCCCCTCTAGAGGGG - Intronic
1140231830 16:73123716-73123738 AAACCTAATCCCCAATTTAGGGG + Intergenic
1149205015 17:54233929-54233951 AAACCTCACACTCTGTAGAGTGG + Intergenic
1149378650 17:56070600-56070622 AAACATAAACCTCTATAGTGAGG - Intergenic
1151899364 17:77001772-77001794 AAACCTAACCCTCTATCCATGGG + Intergenic
1161750080 19:6089479-6089501 AAACCTAACCCCCAATATGACGG + Intronic
1162122971 19:8483514-8483536 AAACAAAACCCCCAAAAGAGAGG - Intronic
1167652760 19:50742056-50742078 AAACCTAACACCCTAAGGACTGG + Intergenic
942442996 2:176055329-176055351 AATCCTAACCCCCAATATAATGG - Intergenic
948331032 2:237165575-237165597 AAACTTAGCTCCCTATGGAGAGG - Intergenic
1168853758 20:994415-994437 AAACCTCAGACCCTATGGAGAGG + Intronic
1183756354 22:39769872-39769894 AAACCTAAATGCCTGTAGAGGGG + Intronic
951603826 3:24409262-24409284 AAACCAAGACTCCTATAGAGTGG - Intronic
951910859 3:27749000-27749022 AACCCTAACCCACCCTAGAGAGG - Intergenic
960441266 3:117692069-117692091 AAATCTAATCCCCTCTGGAGTGG + Intergenic
962173182 3:133124642-133124664 AAAGCCAACCCCTTTTAGAGGGG + Intronic
963279472 3:143368229-143368251 ATACTTAACACCCTCTAGAGAGG + Intronic
963292666 3:143508002-143508024 AAACCTAACCCCCAATTTAATGG - Intronic
964409117 3:156379776-156379798 TAACCTAAGCCCCTATGCAGTGG - Intronic
964610882 3:158613662-158613684 AATCCTAACCCCCAATATAATGG - Intergenic
971246662 4:24935462-24935484 AAACCTAACCCCCAATATGAAGG + Intronic
971704261 4:30019285-30019307 AATCCTAACCCCCAGTAGAATGG + Intergenic
972684888 4:41342723-41342745 AAACCTAATCCCCAATGCAGTGG + Intergenic
973578182 4:52313899-52313921 GAACCTAACCCCAGTTAGAGTGG - Intergenic
977748581 4:100580883-100580905 AATCCTAACCCCCAATATAATGG + Intronic
979752431 4:124295451-124295473 AATCCTAACCCCCAATAGGATGG + Intergenic
986187701 5:5460151-5460173 AAACATAACCCTGTGTAGAGTGG + Intronic
987055092 5:14183659-14183681 AAACCAAACCCATTATGGAGGGG - Intronic
988595215 5:32584775-32584797 AAAGTTAACGCCCTATGGAGAGG - Intronic
988852925 5:35197014-35197036 AATCCTAACCCCCAATATAATGG - Intronic
997407382 5:133662185-133662207 AATCCAAACTCCCTATATAGTGG + Intergenic
999093471 5:148957740-148957762 GACCCCAACCCCCTGTAGAGAGG - Intronic
1000927667 5:167213505-167213527 AAACCTCACCCCCAGTAGATTGG - Intergenic
1000932014 5:167263076-167263098 AAACCTAACCCCTCAGATAGTGG - Intergenic
1010144176 6:72646959-72646981 AAAACTAACCCATTATTGAGAGG + Intronic
1010615900 6:78011963-78011985 AAACCCAACTCCCTACAGAAAGG - Intergenic
1011991106 6:93518820-93518842 AAACCTAATCCCCAATATAATGG - Intergenic
1012505483 6:99941503-99941525 AAACCTAACCCCAAATATAATGG + Intronic
1014168115 6:118248857-118248879 AATCCTAACCCCCAATATAATGG + Intronic
1014712373 6:124822239-124822261 AAACCTCATCCCCTACTGAGAGG + Intronic
1015612828 6:135044270-135044292 AAACCACTCCACCTATAGAGTGG - Intronic
1018047370 6:159977671-159977693 AAAACTAACTCCCTAATGAGAGG - Intronic
1019348105 7:540217-540239 AAGCCTCACCCCCTCCAGAGCGG + Intergenic
1023948609 7:44823393-44823415 AAACCTAACCCCCTATAGAGTGG + Intronic
1033629833 7:143146751-143146773 AAACCCAAGCCCCCTTAGAGGGG + Intergenic
1035295461 7:157864702-157864724 AAACCTGACCTCCTGCAGAGAGG - Intronic
1036058791 8:5291006-5291028 AAACCTCACCCCCAACACAGAGG - Intergenic
1038535141 8:28348397-28348419 CAAGCTAATCCCCTAGAGAGTGG + Exonic
1047362295 8:124180064-124180086 AATCCTAACCCCCAATTTAGTGG - Intergenic
1051409247 9:16771836-16771858 AACCCTAATCCTCTATAAAGAGG + Intronic
1060274687 9:122173421-122173443 AAACCTAACCCCATATGTACTGG - Intronic
1060731709 9:126041390-126041412 AAATCTAACCCCCTATGTGGTGG + Intergenic
1186359289 X:8822840-8822862 AAACCTAGCCCCACATAGAAAGG + Intergenic
1195652561 X:107300469-107300491 AATCCTAATCCCCTCTACAGAGG - Intergenic