ID: 1023954674

View in Genome Browser
Species Human (GRCh38)
Location 7:44874853-44874875
Sequence TAAGGTATAAAGAAGGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023954674_1023954683 15 Left 1023954674 7:44874853-44874875 CCTTTTCCCTTCTTTATACCTTA No data
Right 1023954683 7:44874891-44874913 CTGGTTTCACCCCTGACTGTAGG No data
1023954674_1023954687 30 Left 1023954674 7:44874853-44874875 CCTTTTCCCTTCTTTATACCTTA No data
Right 1023954687 7:44874906-44874928 ACTGTAGGCTAGAATCACCTTGG No data
1023954674_1023954679 -4 Left 1023954674 7:44874853-44874875 CCTTTTCCCTTCTTTATACCTTA No data
Right 1023954679 7:44874872-44874894 CTTAAAATCCCACAGGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023954674 Original CRISPR TAAGGTATAAAGAAGGGAAA AGG (reversed) Intergenic
No off target data available for this crispr