ID: 1023959172

View in Genome Browser
Species Human (GRCh38)
Location 7:44912481-44912503
Sequence TCTCTCTCACTCTGCCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023959172_1023959177 2 Left 1023959172 7:44912481-44912503 CCCTGGGGGCAGAGTGAGAGAGA No data
Right 1023959177 7:44912506-44912528 AGCCAGGGTTTCTAACAGCTGGG No data
1023959172_1023959180 11 Left 1023959172 7:44912481-44912503 CCCTGGGGGCAGAGTGAGAGAGA No data
Right 1023959180 7:44912515-44912537 TTCTAACAGCTGGGGCTCTCAGG No data
1023959172_1023959176 1 Left 1023959172 7:44912481-44912503 CCCTGGGGGCAGAGTGAGAGAGA No data
Right 1023959176 7:44912505-44912527 GAGCCAGGGTTTCTAACAGCTGG No data
1023959172_1023959181 29 Left 1023959172 7:44912481-44912503 CCCTGGGGGCAGAGTGAGAGAGA No data
Right 1023959181 7:44912533-44912555 TCAGGCTCACTGCCCACCCCAGG No data
1023959172_1023959182 30 Left 1023959172 7:44912481-44912503 CCCTGGGGGCAGAGTGAGAGAGA No data
Right 1023959182 7:44912534-44912556 CAGGCTCACTGCCCACCCCAGGG No data
1023959172_1023959178 3 Left 1023959172 7:44912481-44912503 CCCTGGGGGCAGAGTGAGAGAGA No data
Right 1023959178 7:44912507-44912529 GCCAGGGTTTCTAACAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023959172 Original CRISPR TCTCTCTCACTCTGCCCCCA GGG (reversed) Intergenic
No off target data available for this crispr