ID: 1023959180

View in Genome Browser
Species Human (GRCh38)
Location 7:44912515-44912537
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023959172_1023959180 11 Left 1023959172 7:44912481-44912503 CCCTGGGGGCAGAGTGAGAGAGA No data
Right 1023959180 7:44912515-44912537 TTCTAACAGCTGGGGCTCTCAGG No data
1023959173_1023959180 10 Left 1023959173 7:44912482-44912504 CCTGGGGGCAGAGTGAGAGAGAA No data
Right 1023959180 7:44912515-44912537 TTCTAACAGCTGGGGCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023959180 Original CRISPR TTCTAACAGCTGGGGCTCTC AGG Intergenic
No off target data available for this crispr