ID: 1023965156

View in Genome Browser
Species Human (GRCh38)
Location 7:44960293-44960315
Sequence GGAAATGGGCAGATGCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023965147_1023965156 13 Left 1023965147 7:44960257-44960279 CCCACTCCCAGTGCACTAGGGAG No data
Right 1023965156 7:44960293-44960315 GGAAATGGGCAGATGCTGCTGGG No data
1023965144_1023965156 16 Left 1023965144 7:44960254-44960276 CCTCCCACTCCCAGTGCACTAGG No data
Right 1023965156 7:44960293-44960315 GGAAATGGGCAGATGCTGCTGGG No data
1023965150_1023965156 7 Left 1023965150 7:44960263-44960285 CCCAGTGCACTAGGGAGGAGAAT No data
Right 1023965156 7:44960293-44960315 GGAAATGGGCAGATGCTGCTGGG No data
1023965148_1023965156 12 Left 1023965148 7:44960258-44960280 CCACTCCCAGTGCACTAGGGAGG No data
Right 1023965156 7:44960293-44960315 GGAAATGGGCAGATGCTGCTGGG No data
1023965151_1023965156 6 Left 1023965151 7:44960264-44960286 CCAGTGCACTAGGGAGGAGAATG No data
Right 1023965156 7:44960293-44960315 GGAAATGGGCAGATGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023965156 Original CRISPR GGAAATGGGCAGATGCTGCT GGG Intergenic
No off target data available for this crispr