ID: 1023965976

View in Genome Browser
Species Human (GRCh38)
Location 7:44963230-44963252
Sequence GGGGAGCGCCGCCCTCGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 137}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023965961_1023965976 12 Left 1023965961 7:44963195-44963217 CCCAGGAAGCCTCTGCCGAACCC 0: 1
1: 0
2: 0
3: 9
4: 167
Right 1023965976 7:44963230-44963252 GGGGAGCGCCGCCCTCGCCAGGG 0: 1
1: 0
2: 1
3: 9
4: 137
1023965956_1023965976 19 Left 1023965956 7:44963188-44963210 CCCCCTCCCCAGGAAGCCTCTGC 0: 1
1: 0
2: 7
3: 87
4: 650
Right 1023965976 7:44963230-44963252 GGGGAGCGCCGCCCTCGCCAGGG 0: 1
1: 0
2: 1
3: 9
4: 137
1023965958_1023965976 17 Left 1023965958 7:44963190-44963212 CCCTCCCCAGGAAGCCTCTGCCG 0: 1
1: 1
2: 2
3: 38
4: 405
Right 1023965976 7:44963230-44963252 GGGGAGCGCCGCCCTCGCCAGGG 0: 1
1: 0
2: 1
3: 9
4: 137
1023965957_1023965976 18 Left 1023965957 7:44963189-44963211 CCCCTCCCCAGGAAGCCTCTGCC 0: 1
1: 1
2: 5
3: 79
4: 632
Right 1023965976 7:44963230-44963252 GGGGAGCGCCGCCCTCGCCAGGG 0: 1
1: 0
2: 1
3: 9
4: 137
1023965970_1023965976 -10 Left 1023965970 7:44963217-44963239 CCCAACCGCACCCGGGGAGCGCC 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1023965976 7:44963230-44963252 GGGGAGCGCCGCCCTCGCCAGGG 0: 1
1: 0
2: 1
3: 9
4: 137
1023965969_1023965976 -9 Left 1023965969 7:44963216-44963238 CCCCAACCGCACCCGGGGAGCGC 0: 1
1: 0
2: 0
3: 2
4: 76
Right 1023965976 7:44963230-44963252 GGGGAGCGCCGCCCTCGCCAGGG 0: 1
1: 0
2: 1
3: 9
4: 137
1023965959_1023965976 16 Left 1023965959 7:44963191-44963213 CCTCCCCAGGAAGCCTCTGCCGA 0: 1
1: 0
2: 4
3: 17
4: 242
Right 1023965976 7:44963230-44963252 GGGGAGCGCCGCCCTCGCCAGGG 0: 1
1: 0
2: 1
3: 9
4: 137
1023965960_1023965976 13 Left 1023965960 7:44963194-44963216 CCCCAGGAAGCCTCTGCCGAACC 0: 1
1: 0
2: 1
3: 14
4: 161
Right 1023965976 7:44963230-44963252 GGGGAGCGCCGCCCTCGCCAGGG 0: 1
1: 0
2: 1
3: 9
4: 137
1023965968_1023965976 -8 Left 1023965968 7:44963215-44963237 CCCCCAACCGCACCCGGGGAGCG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1023965976 7:44963230-44963252 GGGGAGCGCCGCCCTCGCCAGGG 0: 1
1: 0
2: 1
3: 9
4: 137
1023965965_1023965976 -3 Left 1023965965 7:44963210-44963232 CCGAACCCCCAACCGCACCCGGG 0: 1
1: 0
2: 0
3: 9
4: 270
Right 1023965976 7:44963230-44963252 GGGGAGCGCCGCCCTCGCCAGGG 0: 1
1: 0
2: 1
3: 9
4: 137
1023965955_1023965976 28 Left 1023965955 7:44963179-44963201 CCGGACTCACCCCCTCCCCAGGA 0: 1
1: 0
2: 9
3: 71
4: 658
Right 1023965976 7:44963230-44963252 GGGGAGCGCCGCCCTCGCCAGGG 0: 1
1: 0
2: 1
3: 9
4: 137
1023965963_1023965976 3 Left 1023965963 7:44963204-44963226 CCTCTGCCGAACCCCCAACCGCA 0: 1
1: 0
2: 1
3: 21
4: 184
Right 1023965976 7:44963230-44963252 GGGGAGCGCCGCCCTCGCCAGGG 0: 1
1: 0
2: 1
3: 9
4: 137
1023965962_1023965976 11 Left 1023965962 7:44963196-44963218 CCAGGAAGCCTCTGCCGAACCCC 0: 1
1: 0
2: 2
3: 21
4: 224
Right 1023965976 7:44963230-44963252 GGGGAGCGCCGCCCTCGCCAGGG 0: 1
1: 0
2: 1
3: 9
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023965976 Original CRISPR GGGGAGCGCCGCCCTCGCCA GGG Intronic
900359809 1:2283093-2283115 TGGGGGCGCCTCCCTGGCCATGG - Intronic
901064566 1:6488765-6488787 GGGGAGGGGCTCCCTCCCCAGGG - Intronic
901443519 1:9293266-9293288 CGGGGGCGCCTCCCTCGCCGCGG + Intronic
901637251 1:10676072-10676094 GGGGAGCCCCGCCCTCTTCCTGG - Intronic
901637821 1:10678479-10678501 GGGCAGCACCGCCCCCGCGAGGG + Intronic
901709164 1:11100262-11100284 GGGGATCGTGGCCCTCGCCTGGG - Intergenic
902286126 1:15409828-15409850 GGGGCGCGCGGTCCCCGCCAGGG + Intergenic
906551346 1:46668488-46668510 GGGGCGCGCCGCTCTGGCCCCGG + Intronic
908572177 1:65421005-65421027 GGAGGGCGCCGCTCTCGCCGAGG - Intronic
910981249 1:92961556-92961578 GGGGAGCGCGGCGCGCGCCGCGG - Intergenic
912518323 1:110229378-110229400 GGGAAGGGCCTCCCTCGCCTAGG - Intronic
912945185 1:114078759-114078781 GTGGAGCGCTGCCCTGGCCTGGG - Intergenic
913186428 1:116373772-116373794 GGGGCGCGCAGCCCCCGCCCAGG - Intronic
915359398 1:155277285-155277307 GGGGAGCGCAGCCTGAGCCAGGG - Intronic
916528202 1:165631221-165631243 TGGGTGCGGCGCCCTCGCCTGGG - Exonic
917508345 1:175649127-175649149 GGGCAGCGCCGGCCTGACCATGG - Intronic
920260538 1:204685270-204685292 GGGCAGCGCCGCCGCCGCCGGGG - Intronic
922196717 1:223365022-223365044 CGGGAGCGCCTCCCAGGCCAAGG - Intergenic
923369195 1:233293858-233293880 GAGGAGCACAGCCCTCACCAGGG - Intronic
1065099861 10:22321779-22321801 GGGGAGCCCCCCCCGCGCCCCGG + Intronic
1065712505 10:28532274-28532296 GGGGAGCGCCGCTCGGGGCAGGG - Intergenic
1067328528 10:45292755-45292777 GAGGAGAGCCACCCTCGACAGGG + Intergenic
1071956951 10:90770421-90770443 TGGGAGCCCCGCCCTCTCCATGG - Intronic
1073123208 10:101134293-101134315 CGAGCGCGCCGCCCTGGCCAAGG + Exonic
1073137767 10:101229179-101229201 CGGGATCGGCGCCCTCGCCTCGG - Exonic
1073486201 10:103820555-103820577 GGAGGGGGCCGCCCTCCCCAGGG - Intronic
1076677277 10:132153616-132153638 GGAGAGCACAGCCCTCTCCAGGG - Intronic
1077316404 11:1921230-1921252 GGGCAGCGTGGCCCTCGCCTGGG - Intronic
1081716263 11:45252562-45252584 GGGGAGCTCCTCCTCCGCCAGGG + Exonic
1083590030 11:63888455-63888477 GGGCAGCCCCACCCTCCCCAAGG - Intronic
1084500853 11:69534322-69534344 GGGGAGTGCCGCCCTGGCCCCGG + Intergenic
1084516912 11:69642405-69642427 GGGAAACGCCGCCCGCGCCCAGG + Intronic
1084736802 11:71110651-71110673 CGGGAGACCCACCCTCGCCAGGG + Intronic
1085084479 11:73657643-73657665 GGGGTGCTCCACCCTCTCCAGGG + Intronic
1096254832 12:50056677-50056699 AGGGAGGGCCCCCCTCCCCAAGG + Intergenic
1104989718 12:132618798-132618820 GGTGGGGGCCGCCCGCGCCATGG + Exonic
1110119607 13:71865789-71865811 GGAGAGGGCCGCGCTCGCCGGGG + Intronic
1113656057 13:112068306-112068328 GGTGCGCGCCGCCCGCGCCCGGG - Exonic
1113779531 13:112968463-112968485 GGGGCTCTCCACCCTCGCCATGG - Intronic
1119207710 14:72807020-72807042 GGGTAGGGCAGCCCTCTCCAGGG - Intronic
1121089290 14:91170137-91170159 GGGGAGCCCCGCTTTCTCCAAGG - Exonic
1122296699 14:100709880-100709902 GGGGCGCGGCGGGCTCGCCACGG + Intergenic
1122582271 14:102777975-102777997 GGGGCGCGCAGGCCTCGCTACGG + Intronic
1122688959 14:103522643-103522665 GGGGAGCGCCATCATCGCCGGGG + Intronic
1125440124 15:39692868-39692890 GGGGAGTGGAGCCCTCTCCATGG + Intronic
1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG + Exonic
1136845258 16:33571693-33571715 GCGCAGCTCCGCCCTCGCAAAGG + Intergenic
1137787998 16:51152654-51152676 GGGGCGCGGCCCCCTCCCCAGGG - Intergenic
1203106966 16_KI270728v1_random:1420346-1420368 GCGCAGCTCCGCCCTCGCAAAGG + Intergenic
1203155426 16_KI270728v1_random:1871991-1872013 GCGCAGCTCCGCCCTCGCAAAGG + Intergenic
1142596443 17:1032026-1032048 GAGGAGCAGCGCCCTTGCCAGGG - Intronic
1143027133 17:3947562-3947584 GGGGATGGCCGCCACCGCCAGGG + Exonic
1143148333 17:4790424-4790446 GGCGAGGGCCGCCCCCGGCAGGG + Intergenic
1143501438 17:7341842-7341864 GGGGAGCGCCGCCCTGGGCAAGG + Intronic
1144490049 17:15700523-15700545 TGGGAGCACCGCCCTTTCCATGG + Intronic
1144910914 17:18681436-18681458 TGGGAGCACCGCCCTTTCCATGG - Intronic
1148021807 17:44558234-44558256 GGGGAGCGCCGCCGCCGCCCGGG - Exonic
1149865674 17:60149866-60149888 GGGGAGGGCAGGCCCCGCCAGGG + Intergenic
1151962417 17:77413641-77413663 GGAGAGAGCCCCCCTCCCCAAGG + Intronic
1152520388 17:80852754-80852776 GGGAAGCTCCTCCCTCTCCACGG + Intronic
1152728741 17:81959955-81959977 GAGGACCGCCGCCCGCGCCGAGG - Intronic
1153805482 18:8705905-8705927 GCAAAGCGCCGCCCTCGCCGGGG + Intronic
1161097138 19:2398974-2398996 GCGGAGCCCCTCCCTCTCCAAGG + Intronic
1161124252 19:2546954-2546976 GGGCAGCGCCGGCCTCGTGACGG + Intronic
1161405698 19:4090113-4090135 GGTGAGAGCCGCCATCGCCTGGG + Intergenic
1161973340 19:7596001-7596023 GGGGGGCGCCGCCTCCACCATGG - Exonic
1162932415 19:13963575-13963597 GGGCAGCGCCGGCTTCCCCAAGG - Exonic
1168115599 19:54220112-54220134 GGGGAGCGCCGCCTCCCCCAGGG - Intronic
1168118586 19:54239858-54239880 GGGGAGCGCCGCCTCCCCCAGGG - Intronic
1168344281 19:55642758-55642780 GGAGAGCCCGGCCCTCGCAAGGG + Exonic
925092448 2:1166637-1166659 TGGGGGTGCAGCCCTCGCCAGGG - Intronic
929460849 2:42101341-42101363 GGGGAGCCCCGCCCTCCCCGAGG + Intergenic
933907884 2:86913677-86913699 CTGGAGCGCCGACGTCGCCAAGG + Intronic
934943559 2:98520058-98520080 AGAGAGCACAGCCCTCGCCATGG + Exonic
938406319 2:131035090-131035112 GGGCTGCGGGGCCCTCGCCATGG - Intronic
945381332 2:209145249-209145271 GGGGAGCCCAGCCCACGCCCAGG + Intergenic
946865594 2:224039052-224039074 GGGCAGCGCCGGCCGCGCCCGGG + Intronic
948583810 2:239005795-239005817 GGGGAGCTCCTCCCAAGCCAGGG - Intergenic
949008821 2:241667125-241667147 GGGGAGCCCCGCCCCCTCCCGGG + Intronic
1170630255 20:18058895-18058917 GGGGCGCGCTGCCCTTCCCAAGG + Intronic
1171011326 20:21510864-21510886 CGGGAGCCCCGCCCGCCCCAGGG + Intergenic
1171340392 20:24422599-24422621 GGGGCGCGCTGCCCTCTCCCTGG + Intergenic
1172632589 20:36389022-36389044 TGGGAGCGCCACCCTCACAATGG - Intronic
1175358654 20:58389658-58389680 GGGGAGCGCGGCGAGCGCCAAGG - Intronic
1175981404 20:62740603-62740625 GGGGAGCCCCCACCTGGCCACGG + Intronic
1176161688 20:63651953-63651975 GGGCAGCGCCGTCCTCTCCAGGG - Intronic
1176706237 21:10121439-10121461 AGGCAGCTCCGCCCTCGCAAAGG - Intergenic
1179375486 21:40846834-40846856 GGCGAGCGCAGCCCTCGCTCCGG - Exonic
1181045643 22:20213069-20213091 GAGGAGGGCCGGGCTCGCCAGGG - Intergenic
1181920990 22:26320367-26320389 GGGGGGCATCGCCCTCCCCAAGG + Intronic
1183213230 22:36463824-36463846 GGGGACCCCAGCCCTGGCCAGGG + Intergenic
1183642261 22:39099834-39099856 GGGGAGACCCTCCCTCACCAAGG + Intronic
1184461537 22:44640560-44640582 TGGCAGCGCCGCCCTGGCCCTGG - Intergenic
1185051277 22:48555624-48555646 GGGGTGCACCCCCCACGCCACGG + Intronic
1185121593 22:48974776-48974798 GAGGAGCGCAGCCCTGGGCAGGG - Intergenic
950741992 3:15059347-15059369 GGTGAGTGGGGCCCTCGCCATGG - Exonic
953774891 3:45808290-45808312 GGGCAGCGTCGGCATCGCCAGGG + Intergenic
954362008 3:50126960-50126982 GGGGGGAGCCGCCTTGGCCAGGG - Intergenic
963939733 3:151086420-151086442 GGGGAGGGCCACCCTCGCCTTGG + Intronic
967556340 3:190863043-190863065 AGGGAGCCCGGCCCTCGCCTCGG - Intronic
968486559 4:865839-865861 GGGGCGCGCAGCCCTCTCCCAGG + Intronic
968575892 4:1365985-1366007 GGGCACCGCCGCCCTCGCACCGG + Intronic
968693290 4:2008135-2008157 CGGGATCCCCGCCCTCGCCCAGG + Intronic
979140104 4:117162190-117162212 GGGGGGTGGAGCCCTCGCCAGGG - Intergenic
979862199 4:125707622-125707644 TGGGAGTGGCGCCCTAGCCAGGG + Intergenic
986418158 5:7549288-7549310 TGGGAGTGCTGCCTTCGCCAGGG - Intronic
996329380 5:122312116-122312138 GGGGAGCGGCGCCCGCGGCCGGG + Exonic
996442966 5:123512515-123512537 TGGGGGCGCCGCCCGCGCCCGGG + Intronic
997975375 5:138438957-138438979 GGGGCGCGCCGCCGCCGCCGCGG + Intergenic
998374516 5:141682065-141682087 GGGGAGGGCCGCCGGCGCCGAGG + Intronic
1001462133 5:171925083-171925105 GCGGAGCGCGGCCCTGGGCAGGG + Intronic
1002666788 5:180831229-180831251 GGTCAGCGCCGCCCTTGCGATGG + Intergenic
1004074728 6:12334602-12334624 GGGGAGCTCCCCTCTCACCAAGG - Intergenic
1006396224 6:33789113-33789135 GGGGGGCGGCGTCCTGGCCATGG - Exonic
1009325124 6:62339366-62339388 GGGGTGTGCCTCCCTCTCCAGGG + Intergenic
1011627139 6:89291853-89291875 GGGAAGAGCCGCCCTTGCCTGGG - Intronic
1013538774 6:111087631-111087653 GGGCTCCGCCGCCCTCGCCTCGG + Exonic
1013619374 6:111873138-111873160 GGCGGCCGCCGCCCGCGCCAGGG - Exonic
1016433074 6:144008166-144008188 GGGAAGCGCCCCGCGCGCCAAGG + Intronic
1018650612 6:165988691-165988713 GGGGACAGGCGCCCTCGCCTAGG + Intergenic
1018948258 6:168361948-168361970 GGGCAGCGTTGCCCTCTCCATGG - Intergenic
1019732873 7:2637317-2637339 GGGGAGAGCCGCCGTGGCCTGGG - Intronic
1023965976 7:44963230-44963252 GGGGAGCGCCGCCCTCGCCAGGG + Intronic
1032095654 7:128937537-128937559 GGCGAGAGCCACCCTCGCCAGGG + Intergenic
1036454218 8:8893462-8893484 GCCGAGCGCCGCCCTCCCCCAGG - Exonic
1036811054 8:11867939-11867961 GGGTAGCACCGTCCCCGCCAAGG + Intronic
1038808006 8:30812495-30812517 GGGGAGCGGCGCCCGGGCCGGGG - Exonic
1041108715 8:54466468-54466490 GGAGCGCGCTCCCCTCGCCAGGG + Intergenic
1047208367 8:122821050-122821072 GGAGTGTGCAGCCCTCGCCATGG + Intronic
1049457338 8:142700402-142700424 GGGGAGCCCCGCCCGCCCCGGGG - Exonic
1049686006 8:143939630-143939652 GGGGCGGGCCGGCCTCGCCGGGG - Intronic
1053643524 9:40108556-40108578 AGGCAGCTCCGCCCTCGCAAAGG - Intergenic
1053762627 9:41356934-41356956 AGGCAGCTCCGCCCTCGCAAAGG + Intergenic
1054324380 9:63705784-63705806 AGGCAGCTCCGCCCTCGCAAAGG - Intergenic
1054541228 9:66268048-66268070 AGGCAGCTCCGCCCTCGCAAAGG + Intergenic
1061726120 9:132582848-132582870 GGGCAGCCCCGCCCTTCCCAAGG + Exonic
1061862254 9:133474016-133474038 GCTGATCGCCGCCCTCACCATGG - Exonic
1062337700 9:136079652-136079674 GGGGAGTGCCGGCCACGGCAGGG - Intronic
1062389290 9:136327648-136327670 CGGGAGCGCCCCCCGCGCCGTGG - Exonic
1062412110 9:136430826-136430848 GGAGAACGGCGCCCTCTCCATGG - Intronic
1202791273 9_KI270719v1_random:91528-91550 AGGCAGCTCCGCCCTCGCAAAGG - Intergenic
1185747405 X:2583975-2583997 GGGGGGCGCCCCCAGCGCCAGGG - Intergenic
1190300338 X:49053660-49053682 GGGGAGCGCCGGCCCGGCCGCGG - Intronic
1190649523 X:52555554-52555576 GGAGAGGGCTGTCCTCGCCAAGG + Intergenic
1192709339 X:73563484-73563506 AGGAAGCGCCGCCCCCGCCTCGG + Exonic
1200091424 X:153637864-153637886 GCGGAGGGGCGCCCTGGCCATGG + Intergenic
1200154889 X:153970175-153970197 GGGGAGCTCTGCCTGCGCCAAGG + Intronic
1201065183 Y:10089891-10089913 GGGAAGAGCCTCCCTCTCCAAGG - Intergenic