ID: 1023970402

View in Genome Browser
Species Human (GRCh38)
Location 7:44986698-44986720
Sequence CCCCGAAGCCGTGCGTGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023970395_1023970402 1 Left 1023970395 7:44986674-44986696 CCTCGACGTCACCGCGTAGTCCC 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1023970402 7:44986698-44986720 CCCCGAAGCCGTGCGTGGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 105
1023970393_1023970402 20 Left 1023970393 7:44986655-44986677 CCGCGCGCTGCGCCGCGCACCTC 0: 1
1: 0
2: 1
3: 19
4: 185
Right 1023970402 7:44986698-44986720 CCCCGAAGCCGTGCGTGGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 105
1023970396_1023970402 -10 Left 1023970396 7:44986685-44986707 CCGCGTAGTCCCGCCCCGAAGCC 0: 1
1: 0
2: 1
3: 5
4: 63
Right 1023970402 7:44986698-44986720 CCCCGAAGCCGTGCGTGGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 105
1023970394_1023970402 8 Left 1023970394 7:44986667-44986689 CCGCGCACCTCGACGTCACCGCG 0: 1
1: 0
2: 0
3: 9
4: 45
Right 1023970402 7:44986698-44986720 CCCCGAAGCCGTGCGTGGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023970402 Original CRISPR CCCCGAAGCCGTGCGTGGCC GGG Intergenic
900115636 1:1026690-1026712 CCCCGAAGCCCAGCGGGGCTGGG + Intronic
900428089 1:2589583-2589605 CTGCGAAGCAGTGCGTGGTCAGG - Exonic
901088267 1:6625220-6625242 TGCCGAAGTCGTGCGCGGCCCGG + Exonic
902639615 1:17758488-17758510 CCCAGAATCCCTGGGTGGCCGGG + Intronic
904674942 1:32193312-32193334 CCCAGCAGCCATGCCTGGCCTGG - Intronic
905975443 1:42170847-42170869 CCCCCAGGCCCTGGGTGGCCCGG + Intergenic
907267648 1:53272534-53272556 CCCCATAGCTGTGCATGGCCTGG - Intronic
911943146 1:104073011-104073033 TGCCGAAGTCGTGCGCGGCCTGG + Intergenic
912494730 1:110084162-110084184 CCCCGCACCCTCGCGTGGCCGGG + Intergenic
916070426 1:161166738-161166760 CCCTAAAGCAGTGAGTGGCCGGG + Intronic
916437525 1:164790878-164790900 ACCCGAAGCCCTGCTTTGCCAGG + Intronic
919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG + Intronic
921060363 1:211579414-211579436 TCCCGGAGCCGGGCGTGGGCCGG + Intergenic
1063174445 10:3539046-3539068 CCGGGAACCCGTGTGTGGCCCGG + Intergenic
1066063974 10:31749411-31749433 CCCCGGGGCCGTGCCAGGCCAGG + Intergenic
1067416483 10:46106661-46106683 CCCGGAAGGCGTGTGCGGCCAGG + Intergenic
1067436612 10:46283140-46283162 CCCCGAAGGCGTGTGCGGCCAGG + Intergenic
1070623780 10:78034094-78034116 GCCCGAAGCCCAGCGTGTCCGGG - Intronic
1071526724 10:86363627-86363649 CCGCGCAGGCGTGCGTGGCTCGG - Intronic
1072336465 10:94402712-94402734 CGCCAAAGCCGCCCGTGGCCCGG - Exonic
1073327376 10:102650607-102650629 CCCCACAGCAGTGCATGGCCTGG - Intronic
1076639026 10:131901381-131901403 CCCGGAGGCCGCGCGCGGCCGGG - Intronic
1076889493 10:133276802-133276824 GCCCGAGGCCGCGCATGGCCGGG + Exonic
1080540348 11:33258168-33258190 CCGGGAAGCCGCGCCTGGCCGGG + Intronic
1084010782 11:66347236-66347258 CCACGCTGGCGTGCGTGGCCAGG + Exonic
1085022493 11:73218271-73218293 CCCCGAAGCCGGGCCAGGCAGGG - Intergenic
1085405701 11:76260472-76260494 CCCCCAGGCCGTGCCAGGCCAGG + Intergenic
1085533628 11:77205661-77205683 CCCACAAGCCCCGCGTGGCCAGG - Intronic
1089566637 11:119375256-119375278 CCCCAAAGCCTTGTGTGGACTGG - Intronic
1091555918 12:1573469-1573491 CCCCCTAGTCGTGCGTGGCTGGG - Intronic
1091691039 12:2597715-2597737 CCCCTAAGCAGTCCGTGGCCTGG + Intronic
1096870390 12:54588776-54588798 CGCCGAGTCCGGGCGTGGCCCGG + Intergenic
1101373052 12:104147460-104147482 CCTGGAAGCCGTTCATGGCCTGG + Intergenic
1102247069 12:111362543-111362565 CCCCCAGGCCCTGAGTGGCCTGG - Exonic
1103719593 12:122966210-122966232 CCCCCAACGCGTGCCTGGCCTGG + Intronic
1108518244 13:51222470-51222492 CCCGCAAGCCGAGCGCGGCCGGG + Exonic
1113803015 13:113096239-113096261 CCCCGGAGCTGGTCGTGGCCAGG + Intronic
1120831463 14:89000971-89000993 CCCATAAGCCTTGCGTGCCCTGG + Intergenic
1122993194 14:105248598-105248620 CCCCGCGGCCGGGCCTGGCCGGG + Exonic
1126599906 15:50418070-50418092 CCCCGAATCCCTGCAGGGCCTGG - Intergenic
1128841340 15:70853823-70853845 CCCCGAACTCGCGCGCGGCCCGG + Intronic
1130546947 15:84863608-84863630 CCCCAAAGCCAGGCGCGGCCCGG - Exonic
1132081006 15:98865519-98865541 TGCCGAAGCCCAGCGTGGCCTGG - Intronic
1132776400 16:1597204-1597226 CCCAGAAGGCGTGAGTGGCCTGG + Intronic
1132934929 16:2475311-2475333 CCCCCAACCCGCGCGTGGCCGGG - Intronic
1133280322 16:4661419-4661441 CCCTGAAGCCCTGTGTGTCCAGG - Intronic
1139576807 16:67847104-67847126 GCCCGAAGCCGCGCGGGGCCCGG + Intronic
1139594111 16:67948233-67948255 CCCAGAAACGGGGCGTGGCCCGG + Intronic
1141685241 16:85566336-85566358 CCACGGCGCTGTGCGTGGCCTGG - Intergenic
1147964955 17:44189579-44189601 CCCTGAAGAGGTGAGTGGCCTGG + Exonic
1148553546 17:48564538-48564560 TCCCGCAGCCCTGCGCGGCCCGG - Intronic
1151314307 17:73312212-73312234 CCCGGAAGCCGGGCGGGCCCAGG - Intergenic
1151477421 17:74352058-74352080 CCACGAGGCCGTGCGCCGCCTGG + Exonic
1153466115 18:5389554-5389576 GCCCGAAGCCTTGCATGGACTGG - Intergenic
1161687182 19:5708530-5708552 CTCCCAGGCCGTCCGTGGCCAGG - Intronic
925984897 2:9207326-9207348 CTCCGAAGCCGGACGCGGCCGGG + Intronic
927561306 2:24076274-24076296 CCCCGAAGCCGAGCGAGCTCCGG - Exonic
931762897 2:65432403-65432425 CCCCGGAACCGTGATTGGCCCGG - Intronic
938124571 2:128662681-128662703 TCCCCAAGGCTTGCGTGGCCTGG + Intergenic
945043705 2:205763789-205763811 CCCCGCGGCCGCCCGTGGCCTGG - Exonic
948570599 2:238914911-238914933 CCCGGAACCCGGGCATGGCCTGG - Intergenic
948607065 2:239142610-239142632 CCCAGGAGCCATGCGTGGCAGGG - Intronic
948607072 2:239142653-239142675 CCCAGGAGCCATGCGTGGCAGGG - Intronic
1168758054 20:329460-329482 CCCCGAAGCCATGCTTCACCAGG - Exonic
1172841087 20:37903162-37903184 CCCCGAAGCCGGGGCTGGGCCGG + Exonic
1174402019 20:50281048-50281070 TCCTGAAGCCCTGTGTGGCCTGG + Intergenic
1175561310 20:59933282-59933304 CCCCGAGGCCGAGGCTGGCCAGG + Intronic
1175947863 20:62567043-62567065 CCCCGAGGCCCTGCCTGGCAGGG - Intronic
1179910673 21:44446145-44446167 ACCTGAAGGCCTGCGTGGCCGGG - Intergenic
1179910686 21:44446211-44446233 ACCTGAAGGCCTGCGTGGCCGGG - Intergenic
1182033755 22:27181401-27181423 AACTGAAGCCGTGGGTGGCCTGG + Intergenic
1183370093 22:37427316-37427338 CCCGGAGGCGGTGCTTGGCCCGG - Exonic
1185048146 22:48539355-48539377 CCTCCAGGCTGTGCGTGGCCGGG + Exonic
953925835 3:46982040-46982062 CCCCCAAGCCAGGCGGGGCCAGG + Intronic
967930467 3:194686952-194686974 CCCCGAAGGCGCGCTTAGCCGGG + Exonic
968575383 4:1363974-1363996 CCCCGTGGCCTTGTGTGGCCTGG + Intronic
968575408 4:1364038-1364060 CCCCGTGGCCTTGTGTGGCCTGG + Intronic
968575433 4:1364102-1364124 CCCCGTGGCCTTGTGTGGCCTGG + Intronic
968575458 4:1364166-1364188 CCCCGTGGCCTTGTGTGGCCTGG + Intronic
968575483 4:1364230-1364252 CCCCGTGGCCTTGTGTGGCCTGG + Intronic
968575528 4:1364358-1364380 CCCCGTGGCCTTGTGTGGCCTGG + Intronic
969293175 4:6253373-6253395 CCCCAAGGCCTTGCGTGGCCTGG - Intergenic
969309143 4:6342518-6342540 CCCCAACGACGTGCCTGGCCCGG - Intronic
970394695 4:15654827-15654849 CCTCGAAGCCCTGGGTGCCCCGG - Intronic
985472576 5:54685-54707 CCCAGAAGCCGGAAGTGGCCGGG - Intergenic
986182028 5:5401901-5401923 CCCCAGAGCAGTGCCTGGCCTGG + Intergenic
988482128 5:31639509-31639531 CCCCGAGACCGTGTGTGCCCAGG + Intronic
994107264 5:95961497-95961519 CCCCGCACCCGGGCGCGGCCAGG + Intronic
1003162406 6:3647204-3647226 CCCTGAAGGCGGGAGTGGCCGGG - Intergenic
1008381490 6:50843206-50843228 CGCCGAAGCCGTGCGTGATGAGG - Exonic
1017705723 6:157120926-157120948 CACAGAAAGCGTGCGTGGCCAGG - Intronic
1018913880 6:168120993-168121015 CCCAGAGGCCGTGGGTGGCCAGG + Intergenic
1022442776 7:30447576-30447598 CCCTGGAGCCGAGTGTGGCCCGG + Intronic
1023970402 7:44986698-44986720 CCCCGAAGCCGTGCGTGGCCGGG + Intergenic
1036656345 8:10679736-10679758 CCCTGCAGGCGTGCCTGGCCCGG + Intronic
1036656361 8:10679792-10679814 CCCTGCAGGCGTGCCTGGCCCGG + Intronic
1038326618 8:26577281-26577303 CTCCGGGGCCGGGCGTGGCCGGG + Intronic
1039793984 8:40896888-40896910 CCCAGAAGGGGTGCCTGGCCCGG - Intronic
1048472153 8:134713101-134713123 CCCCGGCGCCGAGCGCGGCCCGG + Intergenic
1049212256 8:141392172-141392194 CCCCGAAGCCGTGCCCGGAGCGG - Intronic
1049470446 8:142772985-142773007 CCCCTGAGCCATGGGTGGCCAGG + Intronic
1053073862 9:35116370-35116392 CACAGAAGCCGCACGTGGCCGGG - Intergenic
1053114514 9:35489793-35489815 CCCGGGAGCCGCGCGTCGCCAGG + Intergenic
1053161240 9:35814837-35814859 CTCCGAAGCCATCCGGGGCCAGG - Intronic
1053475117 9:38377191-38377213 ACCCGAAGCTTTGCCTGGCCTGG + Intergenic
1061032949 9:128097918-128097940 GCCTGGAGCCGTGTGTGGCCAGG + Intronic
1061445406 9:130634543-130634565 CTGCGGAGCCGTGTGTGGCCAGG + Intronic
1203563541 Un_KI270744v1:75982-76004 GCCAGCAGCCGTGGGTGGCCAGG + Intergenic
1186356741 X:8799380-8799402 CCCCAGAGACCTGCGTGGCCCGG + Intronic
1186357068 X:8800495-8800517 CCCCAGAGACCTGCGTGGCCCGG + Intronic
1187419384 X:19121979-19122001 GCCCCAAGCCGTCCGGGGCCCGG + Intronic
1199016199 X:142819343-142819365 CCCAGAAGCCATTCGGGGCCAGG - Intergenic
1200217001 X:154372310-154372332 CCCCTCAGCCCAGCGTGGCCAGG + Intronic