ID: 1023976194

View in Genome Browser
Species Human (GRCh38)
Location 7:45031987-45032009
Sequence TCTCAGCTGCAGGGGGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 375}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023976194 Original CRISPR TCTCAGCTGCAGGGGGTGGT AGG (reversed) Intronic
900352726 1:2243701-2243723 TCTCTGCTGCATGGGATGCTAGG + Intronic
900964166 1:5945957-5945979 TCTCAACTGCAATGGGTGGGTGG - Intronic
901056460 1:6450741-6450763 TCACAGCGGGTGGGGGTGGTGGG - Intronic
901493931 1:9610691-9610713 TCGGAGCTGCTGGGCGTGGTGGG - Exonic
902055032 1:13593625-13593647 TCTGAGCTGCGTGGGGTGGACGG + Intronic
902134461 1:14292821-14292843 TATCAGCTTCAGGGGGTTGGAGG - Intergenic
902966915 1:20011872-20011894 TCTGTTCTCCAGGGGGTGGTGGG + Intergenic
902967351 1:20016618-20016640 TTTCAACTGCAAGGGGAGGTGGG + Intergenic
903237322 1:21958429-21958451 TCTCAGCTGGGGTGGGGGGTGGG + Intergenic
903943123 1:26945280-26945302 TCTCAGGTGCAGGATGTGGATGG + Intronic
905919491 1:41709981-41710003 TCTCAGCTGCTGGTGGAAGTGGG - Intronic
907048449 1:51314145-51314167 CCTCAGCTGAAGGGTGTGTTGGG + Intronic
907321577 1:53606087-53606109 TCCCAGCTCCAGGGGATGGCTGG + Intronic
907666319 1:56436455-56436477 TGTAAGCTTCATGGGGTGGTGGG + Intergenic
908271987 1:62431135-62431157 TCTCATCTGCAGGGGAAGGGTGG - Intergenic
912502506 1:110131392-110131414 GATGAGCTGCAGGTGGTGGTTGG - Intergenic
912570718 1:110619107-110619129 AGGCAGCTGCAGAGGGTGGTTGG - Intronic
913597985 1:120396018-120396040 TCTCAGCTGCAGGTCCTGGGTGG - Intergenic
914089344 1:144483302-144483324 TCTCAGCTGCAGGTCCTGGGTGG + Intergenic
914309267 1:146450913-146450935 TCTCAGCTGCAGGTCCTGGGTGG - Intergenic
914512417 1:148345644-148345666 TCTCAGCTGCAGGTCCTGGGTGG + Intergenic
914592844 1:149122224-149122246 TCTCAGCTGCAGGTCCTGGGTGG + Intergenic
915087725 1:153399435-153399457 TCTCAGCTCCAGGGCTTGGGTGG + Intergenic
915292028 1:154890935-154890957 TCCCAGCTATTGGGGGTGGTGGG - Intergenic
915335455 1:155138366-155138388 TCCCAGGTGCAGTGGGTTGTGGG + Exonic
915565470 1:156710477-156710499 TCTCAGTGCCAGGGGGTGGGGGG - Intergenic
915714166 1:157929053-157929075 TCTCTGGGGAAGGGGGTGGTAGG - Intergenic
915900243 1:159841506-159841528 TGTCAGTTTCAGGGGGTGGGAGG - Intronic
915955876 1:160219495-160219517 GCTGAGTTGCAGGGAGTGGTGGG + Intronic
920080315 1:203368314-203368336 TCCCAGCTGCAGGGCCTGGGAGG + Intergenic
920184606 1:204152121-204152143 CCTCAGCTGCCGGCGGTGGCTGG - Intergenic
920498631 1:206472662-206472684 TCACAGCAGCAGGAAGTGGTGGG + Intronic
920956274 1:210622761-210622783 TGTCAGGTTTAGGGGGTGGTTGG + Intronic
921581759 1:216903778-216903800 CCAGAGCTGCAGAGGGTGGTTGG - Intronic
921647575 1:217635982-217636004 AATTAGCTGCATGGGGTGGTGGG + Intronic
922213621 1:223503562-223503584 TCCCAGCTGGAGGGTGGGGTAGG + Intergenic
922754931 1:228090430-228090452 TGTCACCTGCAGGGAGAGGTGGG + Intronic
922887141 1:229028719-229028741 TCTGAGCTGCTGGGGGAGGTGGG - Intergenic
924608557 1:245555549-245555571 GCTCAGATGAAGGGGGTGCTGGG + Intronic
924676281 1:246181423-246181445 TCTCAGCTGTGGGGAGTGGCAGG - Intronic
1063245385 10:4212515-4212537 TCTCAGCTGCATGTGGTGGAGGG + Intergenic
1064724814 10:18268066-18268088 ACTCAGATGCAGAGGGAGGTGGG - Intronic
1064964705 10:21003273-21003295 TGTCAGCTGCATGGCGTGGGAGG - Intronic
1067767053 10:49094771-49094793 TCTCAGTGGCAGGGGGTGGGGGG + Intronic
1067894283 10:50162513-50162535 TCTCAGCTCCAGGAGGAGGGAGG - Intergenic
1067927609 10:50526265-50526287 TGGCAGCAGGAGGGGGTGGTCGG + Intronic
1067954559 10:50777748-50777770 TCTCAGCTCCAGGAGGAGGGAGG + Intronic
1068886997 10:62108213-62108235 TCTCAGCTGGAGGCTGAGGTGGG - Intergenic
1069728263 10:70595035-70595057 TTTCAGCTTCAGGGGAAGGTGGG + Intergenic
1070827569 10:79400035-79400057 TACCAGCTGCAGGGGTTGGGAGG - Intronic
1071548285 10:86545309-86545331 TCTGTGGTGGAGGGGGTGGTGGG + Intergenic
1072936819 10:99721036-99721058 TCTCAACTGTAGGAGTTGGTGGG + Exonic
1073431237 10:103488791-103488813 TCTGAACTTCAGGGGGTGGCTGG - Intergenic
1073688618 10:105783377-105783399 TCTGGGCTGGAGGGGGTGGGGGG - Intergenic
1075801057 10:125153513-125153535 TCTCTGCTGGAGGGGGTGAAAGG - Intronic
1076081088 10:127581055-127581077 GCTCTGCTGCAGGGTGTGTTGGG - Intergenic
1076770375 10:132659635-132659657 TCTCCTCTGCAGGGGACGGTGGG - Intronic
1076871674 10:133197795-133197817 TGTCAGGTGCAGGAGCTGGTGGG - Intronic
1077153955 11:1083300-1083322 CCTCTGCTGGAGGGGGTGGTGGG + Intergenic
1077404237 11:2375759-2375781 TGTCCTCAGCAGGGGGTGGTAGG - Intergenic
1077415677 11:2423228-2423250 TCGGAGCTGCAGGGGGTCGCTGG - Intergenic
1077461810 11:2714552-2714574 TCACAGCTGCAGGGAGTGTTGGG + Intronic
1077494546 11:2880560-2880582 TCTCAGCTGCTGGGTGAGGAAGG - Intergenic
1078258624 11:9683279-9683301 TCCCAGCTGCTGGGGGTGAGGGG + Intronic
1082922411 11:58509937-58509959 TCTTTGGTGCAGGGTGTGGTGGG + Intergenic
1083144379 11:60748035-60748057 TCTCAGCGGCAGGGGGATGAAGG + Intergenic
1083329288 11:61890173-61890195 CCTCAGCTTCATGGGGTGGAAGG + Intronic
1083783612 11:64931419-64931441 TGCCAGCTGCAGGGGGTGACAGG - Exonic
1083968408 11:66057345-66057367 TCTCATCTCCAGGGGGCGGTGGG - Exonic
1085049604 11:73373401-73373423 TCTTAGCTCCAGGGGAGGGTGGG - Intergenic
1086569282 11:88263773-88263795 TGTCAGCTACTGGGGGTGGCTGG + Intergenic
1087005067 11:93462319-93462341 TATCAGCTGAAGGAGATGGTGGG - Intergenic
1088459819 11:110070798-110070820 AGTCAGCTGGAGGGGGTGTTTGG - Intergenic
1088888848 11:114029314-114029336 TCTCAGCTCCAGATGGTGGAAGG - Intergenic
1089056644 11:115591029-115591051 TGACTGCTGCTGGGGGTGGTTGG + Intergenic
1089127852 11:116190022-116190044 TCTCAGGAGCTGGGGGTGGAGGG + Intergenic
1089137077 11:116258074-116258096 CATCAGCTCCCGGGGGTGGTGGG - Intergenic
1089875932 11:121722453-121722475 TCCGAGAAGCAGGGGGTGGTGGG - Intergenic
1090245271 11:125211722-125211744 TTTGGGCTGCAGGGGGAGGTGGG + Intronic
1091047876 11:132341121-132341143 TCAAAGCTGAAGAGGGTGGTTGG - Intergenic
1091789932 12:3266219-3266241 TCCCAGCAGCAGGAGGTGGTGGG + Intronic
1092796984 12:12121364-12121386 TCTGTGCTGCAGGGTGTGGTGGG + Exonic
1095908088 12:47397713-47397735 TCTCAGCTCCAGGGAATGGAGGG - Intergenic
1095969475 12:47891909-47891931 TTTCTGCTTCAGGTGGTGGTGGG - Intronic
1095974461 12:47929667-47929689 TCTCAGCAGCAGTGTGTGGGTGG - Intronic
1096218265 12:49810163-49810185 TAGCAGCTGCCGGGGGTGGGGGG + Intronic
1096465934 12:51847912-51847934 TCTCAGAGTCAGGGGGTTGTAGG - Intergenic
1097704067 12:62849489-62849511 TCTCTGCTGCATAGGGTAGTGGG - Intronic
1098787900 12:74782384-74782406 AATCAGCTGCAGGGGGTTGGTGG + Intergenic
1100901479 12:99245968-99245990 TGTCAGCTGCAGTGCTTGGTAGG + Intronic
1101080175 12:101173630-101173652 TCTCAGCTGGAGTGCATGGTGGG + Intronic
1101248459 12:102908200-102908222 TCGGGGCTGCAGGGGGTGGTAGG - Intronic
1101448049 12:104752170-104752192 TCCCAGCTGCTGGTGGTGGCCGG + Intronic
1101736266 12:107465578-107465600 GCTCAGGGGCAGGGGGTGCTGGG + Intronic
1102632453 12:114293201-114293223 TGTTAGCTGCAGGGGTTGGCTGG - Intergenic
1104791219 12:131483305-131483327 TCTCAGCTGCTGCGTGTTGTGGG + Intergenic
1104871850 12:132005060-132005082 GCTCAGCTGCAGAGGGTTGCGGG - Exonic
1105624072 13:22096321-22096343 GAGCAGCTGCAAGGGGTGGTAGG + Intergenic
1106300798 13:28462902-28462924 TCTCAGTGGCAGGAGGAGGTCGG - Intronic
1108564810 13:51685366-51685388 TCTCAACTGGAAGGGGAGGTGGG - Intronic
1109068692 13:57735384-57735406 TCTCAGCTGCAGGGAGATGCTGG - Intergenic
1113146060 13:107208886-107208908 TCTCTGCTGGAGGGGGAGGAGGG - Intronic
1113970447 13:114184996-114185018 TGTCAGTTGCAGTGGGTGGGGGG + Intergenic
1114619150 14:24084617-24084639 GCTCAGCTCCAGGGGGCTGTGGG + Intronic
1116423570 14:44762504-44762526 TATTGGCTGCAGGGGATGGTGGG - Intergenic
1117841284 14:59862975-59862997 GCACACCTGCAGGGAGTGGTTGG - Intronic
1118715743 14:68558527-68558549 TCTCAGCTTCTGGTGGTGGCCGG + Intronic
1118761932 14:68885350-68885372 TCTCAGCTGCTGGGGGAGGTGGG - Intronic
1118850541 14:69579851-69579873 ACTGAGCTGAAGTGGGTGGTGGG - Intergenic
1119739192 14:77003149-77003171 TCTCTGCAGCAGAGGATGGTGGG + Intergenic
1120079645 14:80201452-80201474 TCTCAGCTGCTGCGGGAGGTAGG - Intronic
1121278040 14:92680961-92680983 TCACAGGGGCAGGGGGTGGGGGG - Intronic
1121397310 14:93637423-93637445 TCTCAGCCACTGGGGGTGTTTGG - Intronic
1121651757 14:95564043-95564065 TCTCATGGGCAGGGAGTGGTAGG + Intergenic
1122255170 14:100471136-100471158 TCTCTGCTGCTGAGGGTGGTTGG + Intronic
1122329592 14:100903662-100903684 CTTCAGCAGCAGGGTGTGGTGGG - Intergenic
1122731253 14:103800202-103800224 TCTCAGCTGGAGGCTGAGGTGGG + Intronic
1122790640 14:104182849-104182871 GCTCACCTGCAGGGGATGGGTGG + Intergenic
1122945296 14:105005898-105005920 GCGCAGCTGGAGGGGGTGCTGGG - Intronic
1124180102 15:27465136-27465158 TCTCAGCTGCTGGTGGAGGGGGG + Intronic
1124388405 15:29229393-29229415 TGTCAGGTATAGGGGGTGGTAGG - Intronic
1124686652 15:31788666-31788688 TGGCAGCTGCAGGAGGTGGAAGG + Intronic
1125953826 15:43776143-43776165 TCTCAGATACTGGGGGTGGAAGG + Exonic
1126944868 15:53808553-53808575 TCCCAGCTGCAAGAGGAGGTAGG - Intergenic
1128039514 15:64558390-64558412 TTTCAGCTTCATAGGGTGGTTGG + Intronic
1129486481 15:75878472-75878494 TCCCAGCTACTGGGGGTGGTGGG + Intronic
1129890165 15:79066588-79066610 TCAGAGCTGCATGGGGTGATGGG + Intronic
1130008906 15:80131753-80131775 TATCAGATGCAGATGGTGGTGGG + Intronic
1130386550 15:83417068-83417090 TCTGCGCTGCAGGTGTTGGTAGG + Intergenic
1131407020 15:92173444-92173466 ACTCAGCTGCAGTGGATGATGGG - Intergenic
1132418649 15:101644321-101644343 TCACAGCTGCAAGGGATGGGGGG + Intronic
1132554323 16:565975-565997 TCACGGCTGCAGGGGCTGGCAGG - Intergenic
1132641289 16:979765-979787 TCCCAGGGGCAGGGGGTGGAAGG + Intronic
1132999186 16:2840664-2840686 TCCCAGCTTCAGGGTGGGGTGGG + Intergenic
1133059532 16:3165409-3165431 TCTCAGCTGAACTGGGTGGGAGG - Intergenic
1133867516 16:9658060-9658082 TCTCAGCAGCCGGGGGCGGGGGG + Intergenic
1135415750 16:22266894-22266916 ACCCAGCTGCAGGTGGGGGTGGG + Intronic
1136369265 16:29825753-29825775 CCTCAGCTGTGGGGGGTGTTGGG + Intronic
1137546955 16:49411210-49411232 TCTCAGCTGGGGTGGGTGGCAGG - Intergenic
1137776336 16:51057364-51057386 TCTAAGCTGCAGGGATGGGTGGG - Intergenic
1138199928 16:55080983-55081005 TCTCAGGTGCATGGGGTGGCAGG + Intergenic
1138601532 16:58057826-58057848 CCTCAGCTTCAGGGGCAGGTGGG + Intergenic
1139374548 16:66488580-66488602 TCCCAGCTACAGGGGAGGGTGGG + Intronic
1141143921 16:81515743-81515765 TCTGATCTGCTGGGTGTGGTCGG + Intronic
1141993400 16:87622745-87622767 TCTCAGCGGCAGGGTGGGGCGGG - Intronic
1142599543 17:1046975-1046997 TCTCAGCGGCGGGGTGGGGTGGG - Intronic
1143014658 17:3885319-3885341 TCTCAGATGCAGAGGTTGGTGGG - Exonic
1144497520 17:15757884-15757906 CCTCAGGTGCAGGGGGTAGCGGG - Intergenic
1144629313 17:16862368-16862390 CCTCAGGTGCAGGGGGTAGCGGG - Intergenic
1144652112 17:17013747-17013769 CCTCAGGTGCAGGGGGTAGCGGG + Intergenic
1144737449 17:17563100-17563122 TCTCAGCAGCAGGGGAGAGTTGG + Intronic
1145160884 17:20572934-20572956 CCTCAGGTGCAGGGGGTAGCGGG - Intergenic
1145235533 17:21205447-21205469 TCTCCGCTGCAGGAGGAGGCAGG + Intronic
1146139433 17:30352470-30352492 TCTCAGCTACTGGGGGTTGGGGG - Intergenic
1147043438 17:37735412-37735434 TCCCAACTGCAGGTGGTGTTGGG + Intronic
1147430319 17:40366865-40366887 CCTGAGCTGGAGGGAGTGGTGGG - Intergenic
1147644516 17:42025850-42025872 TCACAGTGGCAGGGGCTGGTTGG + Intronic
1147703652 17:42411606-42411628 CCTCAGCTGCAGGGAGTGGGTGG + Intronic
1147746575 17:42698629-42698651 TTTCTGCTGCTGGGGCTGGTGGG + Exonic
1149984963 17:61340322-61340344 ACACAGATGCAGGGGGTGGGTGG + Intronic
1150281534 17:63932018-63932040 TGTCAGCTGCACGTGGTGATGGG - Intronic
1150476874 17:65482391-65482413 TCACATCTGCTGGGGGTGTTGGG - Intergenic
1151425864 17:74030715-74030737 TCTCTGCTACTGGGGGTGCTGGG - Intergenic
1151811590 17:76446255-76446277 TGTCAGCTGCCGCTGGTGGTCGG - Intronic
1152038916 17:77890766-77890788 TCTCAACTGTGGGGGGTGGGTGG - Intergenic
1152534601 17:80943199-80943221 TGTCAGCTGCTGGAGGTGGGCGG + Intronic
1152613085 17:81325066-81325088 TCTCAGCTCCTGGGGGCGGCTGG + Intronic
1153128166 18:1821588-1821610 TATCAGATGAAGGGGCTGGTAGG + Intergenic
1154134109 18:11761064-11761086 CCTCAGTTGCTGGGGCTGGTTGG + Intronic
1155527191 18:26729412-26729434 TCTTAGCTGGATGGGATGGTAGG + Intergenic
1157573050 18:48725524-48725546 TCTCACCCTAAGGGGGTGGTGGG - Intronic
1157603321 18:48909124-48909146 TGTCAGCGGGAGGGGGTGGGAGG - Intergenic
1159084255 18:63770250-63770272 TTATAGCTGCAGGGTGTGGTTGG + Intronic
1159257624 18:65967689-65967711 TCTCAGCAGCTTGAGGTGGTGGG - Intergenic
1159599931 18:70419271-70419293 TCTCAGCTGAAGGAGGTTTTGGG + Intergenic
1160341744 18:78095167-78095189 TGTAAGCTGCATGGGGTGGGAGG + Intergenic
1160558167 18:79739575-79739597 TCCCAGCTGCAGGAGGTGGTTGG + Intronic
1160678340 19:402097-402119 TCTCAGCTCCTGGGGGTGGGAGG - Intergenic
1160762815 19:794157-794179 TCTAAGCTTCAGGTGGTGGGTGG + Intergenic
1160854039 19:1207965-1207987 TCCCAGCTGGTGGGGGTGGCCGG + Intronic
1160857045 19:1222332-1222354 TCCCAGCAGCAGGGTGTGGCTGG + Intronic
1160935724 19:1593607-1593629 ACTAAGGTGCAGGGGGTGGTCGG - Intergenic
1160994091 19:1873771-1873793 TCCCAAGAGCAGGGGGTGGTGGG + Intergenic
1161175535 19:2840601-2840623 TCTCAGCTACTGGGGATGCTGGG - Intergenic
1161385557 19:3990408-3990430 ACTCAGCTGCAAGGGTTGGTGGG + Intergenic
1161476951 19:4491471-4491493 GCTCAGCTGTCGTGGGTGGTGGG + Intronic
1162121963 19:8476211-8476233 TCTCAGCTGTAGAGGGTGTGGGG - Intronic
1162552123 19:11363857-11363879 TCCCGGCTGGAGAGGGTGGTGGG + Intronic
1162823362 19:13236578-13236600 TCTCAGCTTCTGGGGCTGGGTGG + Intronic
1163132795 19:15286206-15286228 TCTCATCTGCTCGGGGTGGAGGG - Intronic
1163382366 19:16977514-16977536 CCTCAGCTTCTGGGGCTGGTGGG + Exonic
1163384247 19:16989637-16989659 TCTTACCTGCAGTGGGTGGGAGG + Exonic
1163621470 19:18363369-18363391 TCTAAGCCGCAGGGCGTGGCGGG - Exonic
1164497671 19:28783322-28783344 CCTCCCCTGAAGGGGGTGGTGGG + Intergenic
1164769891 19:30800399-30800421 TCTCGGCTGAAGGAGGTGGAAGG - Intergenic
1164851748 19:31489895-31489917 TCTCATTTGCTGGGGGTGGAGGG + Intergenic
1165170324 19:33887701-33887723 TCTCAGCTGGTGGGGGTTGGGGG - Intergenic
1165283533 19:34817839-34817861 TTTTGGCTGCAGGGGGTTGTGGG + Intergenic
1165361891 19:35341843-35341865 TCTCAGCTTCTGGCTGTGGTAGG - Exonic
1165404737 19:35622705-35622727 CCTGAGCTGCAGGGGATCGTGGG + Exonic
1166200014 19:41231282-41231304 TCTCACCTGCAGGGTGCAGTGGG - Exonic
1166713413 19:44951422-44951444 TGCCAAGTGCAGGGGGTGGTGGG + Intronic
1167920431 19:52779011-52779033 TCTCTGGTGCAGTGGGCGGTGGG - Intronic
1168187713 19:54710236-54710258 TCTCAGACGCAGTGGGTGATGGG - Intergenic
1168214647 19:54916640-54916662 TATCAGGGGCTGGGGGTGGTAGG - Intergenic
927482085 2:23462081-23462103 TCTCAGCTGCTGAGGGAGGCAGG + Intronic
928653066 2:33422262-33422284 TCTTAGATGCAGTGGGTGGTTGG - Intergenic
929083257 2:38142425-38142447 CCTCAGGGGCAGGGTGTGGTGGG - Intergenic
929814497 2:45220305-45220327 CCCCGGCTGCAGGGGGTGGTTGG + Intergenic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930110560 2:47675375-47675397 GCTCAGCTGCCGGAGGGGGTTGG - Intergenic
931331961 2:61296139-61296161 TCTCAGCTACTGGGGAAGGTTGG + Intronic
932128976 2:69170262-69170284 TCTCCTCGGCAGGGGGTGGAGGG - Exonic
932777219 2:74535582-74535604 ACTCACCTGCAGGCCGTGGTTGG + Exonic
933063472 2:77767676-77767698 TCGCAGCTTCAGGGGGTGGGAGG - Intergenic
934939442 2:98489868-98489890 TTGCAGCTGCATGGGGTGGGGGG - Intronic
935127146 2:100234671-100234693 TCTCATCTGCAACGTGTGGTTGG + Intergenic
937262359 2:120594723-120594745 TCTCTGTTGCAGAGGGTGGAGGG + Intergenic
937523549 2:122739952-122739974 GCTCAGCTGCAGGAGCTTGTTGG + Intergenic
937903744 2:127041627-127041649 TGTGACCTGCAGGGGGTGGCTGG - Intergenic
939323389 2:140653874-140653896 AATCAGCTGAAGGTGGTGGTGGG + Intronic
940360723 2:152793114-152793136 TCTCTGCTGCAGGAGAGGGTAGG + Intergenic
942497926 2:176559063-176559085 TCTCAGTTTCAGGAGGTGTTGGG + Intergenic
946815767 2:223577201-223577223 TCCCAGCTTCAGATGGTGGTGGG - Intergenic
947092457 2:226527670-226527692 TTTCAACTGCACAGGGTGGTTGG + Intergenic
947563583 2:231178976-231178998 TCTCACCTGCATGAGGTGTTAGG - Intergenic
947895308 2:233665892-233665914 TCTCATATGCAGGTGGTGGGAGG - Intronic
948058202 2:235025231-235025253 TCTCAGCGGCAGGGTGAGGGCGG + Intronic
948174002 2:235928895-235928917 TCACAGCAGCCGGGGGAGGTGGG - Intronic
1168924556 20:1568451-1568473 TCTCAGCCCCAGTGGGTGGTTGG + Intronic
1169318063 20:4609482-4609504 TCTCAGCTGCTAGGGATGGCTGG - Intergenic
1169381037 20:5107372-5107394 TCAGAGCTGCACTGGGTGGTAGG - Intronic
1170127175 20:12976742-12976764 TCCCAGCTTCAGGGGCTAGTGGG - Intergenic
1170836404 20:19888517-19888539 GTTCAGCTGCAGGGGTGGGTAGG - Intronic
1172117524 20:32581691-32581713 ACCCAGCTGTCGGGGGTGGTGGG - Intronic
1172878658 20:38182470-38182492 CCTCAACTGCAGGGGCTGGAAGG + Intergenic
1175327234 20:58138098-58138120 TGTCAGCCCCAGTGGGTGGTGGG - Intergenic
1175327548 20:58140237-58140259 CCTCAGCTCCTGGGGGAGGTCGG + Intergenic
1175528150 20:59650763-59650785 TCTCAGGGGTTGGGGGTGGTGGG + Intronic
1175730811 20:61352849-61352871 TCACAGGTGCACGGGGTGATGGG - Intronic
1176085520 20:63293898-63293920 GTTCGGCTGCAGGGGGTGGGAGG + Intronic
1177250867 21:18589170-18589192 AGTCATTTGCAGGGGGTGGTAGG - Intergenic
1179132065 21:38646595-38646617 TGTCAGCTACAGGGCGTGGGTGG + Intronic
1179140738 21:38722786-38722808 TCTCAGGGGCAGGGGGTGCGAGG + Intergenic
1179250050 21:39664717-39664739 ACCCAGCCACAGGGGGTGGTGGG - Exonic
1179474086 21:41632222-41632244 TCTGAGCTGCAGGGGGGCTTTGG + Intergenic
1179906563 21:44426019-44426041 TCACAGCTGGAGGTGGTGGAGGG + Intronic
1180931718 22:19596757-19596779 CCCCAGCAGCAGAGGGTGGTGGG - Intergenic
1181176296 22:21038572-21038594 TGCCAGCTGCAGGGGTTGGGAGG + Intergenic
1181433946 22:22899548-22899570 TCACAGCTGCAGTGGGGGCTGGG + Intergenic
1181434882 22:22904917-22904939 TCACAGCTGCAGTGGGGGCTGGG + Intergenic
1181436495 22:22914202-22914224 TCACAGCTGCAGCGGGGGTTGGG + Intergenic
1181511810 22:23392731-23392753 TCCCAGGGGCAGGGGGTAGTGGG + Intergenic
1182698510 22:32212206-32212228 TCACAGCTGCAGTGGGGGCTGGG + Intergenic
1183395352 22:37568292-37568314 TCTCAGCTGCAGGGGCTTCTGGG - Exonic
1183489229 22:38107967-38107989 TTTCAGCGGAAGAGGGTGGTGGG - Intronic
1184260186 22:43310485-43310507 TCACAGCTGGTGGTGGTGGTTGG - Intronic
1184275220 22:43405999-43406021 GCTCAGCTGGAGGGGGTGACTGG + Intergenic
1184322481 22:43753114-43753136 CCTCTGCTGCTGGGGGCGGTGGG - Intronic
1184578474 22:45394522-45394544 TCTCAGCTACAGGCTGAGGTAGG + Intronic
1184815465 22:46865607-46865629 TCACAGCTGAAGGGGCTGGAAGG - Intronic
949528749 3:4932629-4932651 TCCCAGCTGCTCGGGGTGGCGGG + Intergenic
950130904 3:10546215-10546237 TCCCAGCTCCAGGGGGCAGTTGG - Intronic
950216255 3:11161859-11161881 TCTCTCCTGTAGGGGGCGGTGGG + Intronic
950374018 3:12555753-12555775 TCGAGGCTGCAGGGGGTGGGTGG - Intronic
950542538 3:13620949-13620971 TCTCAGGTCCAGGTGGTGCTGGG + Intronic
951631484 3:24726092-24726114 TCTCAGCTTCAGGGCATTGTTGG + Intergenic
952325170 3:32314282-32314304 TCAGGGCTGCAGGGGCTGGTTGG + Intronic
952605699 3:35144880-35144902 TCTCAGCAGCTGGGTGTGGGGGG + Intergenic
952687252 3:36163969-36163991 TGTGAGCTGCTGGTGGTGGTTGG + Intergenic
954553433 3:51500648-51500670 TCTCAGCTGGAGGCTGAGGTGGG - Intergenic
955322102 3:57981791-57981813 TCTCTGCTGCAGGGAGACGTGGG + Intergenic
956027199 3:64995947-64995969 AAACAGCTGCAGGGGGTGGGGGG - Intergenic
957254935 3:77824953-77824975 TCTCTTCTGTAGGGGGTGGGGGG + Intergenic
957315138 3:78567048-78567070 TCTTAGCTGTAGTGGGTGCTGGG - Intergenic
957781476 3:84822815-84822837 TATCAGCTGCAGGTGGGGATTGG + Intergenic
959887088 3:111515552-111515574 TCTCAGCTTCAGGAGGCAGTGGG - Intronic
961142593 3:124567612-124567634 TCACAGCAGCAGGTGGTGGAGGG + Intronic
961219888 3:125191476-125191498 TCTCAGCTGGGTGGGGTGGGTGG + Intronic
961482601 3:127193569-127193591 TCGCAGCTGCAGCGGGTGGAGGG - Intronic
961785405 3:129344158-129344180 GCTCTGCTGCAGGTGGGGGTGGG + Intergenic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
962870111 3:139481199-139481221 TCTCAACTGTTGGGGGAGGTTGG - Intergenic
963888241 3:150604056-150604078 TGACAGCTGGAGGGGGTGGAAGG + Intronic
964246466 3:154659705-154659727 TCTCAGGTGGTGGGGGTGGGAGG + Intergenic
966048140 3:175578304-175578326 TCCCAGCTACTGGGGATGGTGGG + Intronic
966562837 3:181342619-181342641 TCTCAGCTACTGGGTGTGGTGGG - Intergenic
967351989 3:188524174-188524196 TCTCAGGTCCAGGGGGTATTAGG - Intronic
969220607 4:5756171-5756193 CCTGAGATGCAGGGGATGGTTGG + Intronic
969842595 4:9893388-9893410 TCTCATTTGCAGGGGGAGGGCGG + Intronic
970312108 4:14793402-14793424 GTTCTGCTGCAGGTGGTGGTGGG - Intergenic
973801666 4:54484463-54484485 TCTCATCTGCATGGGGTGGTTGG - Intergenic
975487805 4:74953776-74953798 TCTCAGATGTCGGTGGTGGTGGG - Intronic
980015558 4:127646065-127646087 TCTCAGCTGCTGGGGAGGCTGGG + Intronic
981086215 4:140687172-140687194 TCACAGCTGCAGGGTGTAATAGG + Intronic
981546868 4:145902758-145902780 ACTGAGCTGCTGGGCGTGGTGGG + Exonic
981585989 4:146302961-146302983 CCACAGCTGCAGGGAGTGTTAGG + Intronic
982721888 4:158868382-158868404 TCTCTGCTGCTGTTGGTGGTAGG - Exonic
984645008 4:182209882-182209904 AGTCATCTGCAGGGGGAGGTGGG + Intronic
985809998 5:2075780-2075802 TCCTAGCTGCCTGGGGTGGTAGG + Intergenic
985977773 5:3434565-3434587 GCTCCGCTTCAGAGGGTGGTAGG - Intergenic
987309307 5:16667299-16667321 TCCCAGCTGGAGGAGGTGGCTGG - Intronic
991403055 5:66274293-66274315 TCTGACCTCCAGGGAGTGGTGGG - Intergenic
991459979 5:66847670-66847692 TATTAGCTGGAGGTGGTGGTGGG + Intronic
991657488 5:68918582-68918604 TCTGGGGGGCAGGGGGTGGTGGG + Intergenic
994381850 5:99080306-99080328 ACTCTGCTGCTGTGGGTGGTTGG + Intergenic
997699134 5:135884185-135884207 ACTCAAAGGCAGGGGGTGGTTGG - Intronic
998814869 5:146002902-146002924 CCTCAGATGCAGGGGGTAGGAGG - Intronic
999234935 5:150084884-150084906 TCTGAGATGAAGGGGGTGGCGGG + Intronic
1002494481 5:179602444-179602466 TCTCTGCTGCAGGTGCTGATGGG + Intronic
1003186147 6:3832513-3832535 TCTCAGATGCAGTGGCTGGCTGG + Intergenic
1003303368 6:4904878-4904900 TCTCAGCTGGAGGTCGGGGTGGG - Intronic
1005087894 6:22025610-22025632 TCCCAAGTGCAGGGGGTGGAGGG - Intergenic
1005187065 6:23174510-23174532 ACGTAGCAGCAGGGGGTGGTGGG + Intergenic
1006929251 6:37677908-37677930 ACCCAGCTGCAGGGGGAGATAGG + Intronic
1007252902 6:40508428-40508450 TCTGATCAGCAGTGGGTGGTGGG + Intronic
1007513992 6:42396771-42396793 CCTCAGCTGCCTGGGATGGTGGG + Intronic
1007736139 6:43983368-43983390 TCGGAGCTGCACAGGGTGGTGGG + Intergenic
1008193133 6:48484623-48484645 TAGCAGATGCAGTGGGTGGTAGG - Intergenic
1011142347 6:84172566-84172588 TCTCTGTTGGAGGGGTTGGTCGG + Intronic
1013280836 6:108635601-108635623 GCTGAGCTGCAGGAGGTGCTGGG + Intronic
1013315039 6:108933443-108933465 TCTCAGCTGAAGGAGGTTTTGGG + Intronic
1014542470 6:122693304-122693326 TCTCACTAGCAGGGGGCGGTGGG - Intronic
1014810965 6:125885147-125885169 TTTCTCCTGCAGGGTGTGGTTGG + Exonic
1015234620 6:130956323-130956345 TTTCAGCTGCAGGAGGTGGCTGG + Exonic
1015885187 6:137910619-137910641 CCTCAGCTCCAGGGGAGGGTGGG + Intergenic
1016075324 6:139788724-139788746 TGTCAGTGGGAGGGGGTGGTGGG + Intergenic
1018061922 6:160096842-160096864 GCACTGCTGCTGGGGGTGGTGGG - Intronic
1018186486 6:161269522-161269544 TCCCAGCTGCTGGGGGAGGGGGG + Intronic
1019678436 7:2329949-2329971 TCTCAGCTACATGGGGCGGGGGG - Intronic
1019700135 7:2470813-2470835 TCTGAGCTGAAGGGGCAGGTGGG + Intergenic
1019706954 7:2501516-2501538 TCTCAGCTGCAGAGGGGGTATGG + Intergenic
1019894215 7:3971182-3971204 CCACACCTGCATGGGGTGGTCGG + Intronic
1020560877 7:9727794-9727816 CCTCAGCTTCTGGGGCTGGTGGG - Intergenic
1022277754 7:28872761-28872783 TCCCAGCTGCTGGGAGTGCTTGG + Intergenic
1023131223 7:37005350-37005372 TCTCAGCTGCATGGGGTCCATGG - Intronic
1023372883 7:39529707-39529729 ACCCAGCAGCAGAGGGTGGTGGG + Intergenic
1023595158 7:41821949-41821971 TCTCAGCTGGAAGGGGTGTGAGG - Intergenic
1023743283 7:43300265-43300287 TCTCAGCAGCAGGCTGTGATAGG - Intronic
1023893034 7:44407163-44407185 ACTCAGCTGTCGGTGGTGGTGGG + Intronic
1023976194 7:45031987-45032009 TCTCAGCTGCAGGGGGTGGTAGG - Intronic
1024142965 7:46480694-46480716 CCTCAGCTGCAGGTTGGGGTTGG + Intergenic
1024556164 7:50605140-50605162 TCTCAGCTGCAGGAAGCAGTTGG - Intronic
1024961487 7:54981430-54981452 TGGCTGCTGCAGGGGGTGGGTGG - Intergenic
1026634729 7:72071354-72071376 TTTCAGCTGCAGGGCAGGGTTGG - Intronic
1027132047 7:75598097-75598119 TCTTAGCTTCAGAGGTTGGTTGG - Intronic
1028747840 7:94347699-94347721 TCTCAGCAGCAAAGGGTGATGGG - Intergenic
1033579785 7:142721763-142721785 ACTCTGCTGCAGAAGGTGGTAGG + Intergenic
1035226798 7:157438213-157438235 TCACAGCTGTGGGGGGCGGTGGG + Intergenic
1036145205 8:6248577-6248599 TCAGAGGTGGAGGGGGTGGTGGG - Intergenic
1036630898 8:10514322-10514344 TCTGAGCTGTAGGTAGTGGTGGG - Intergenic
1038260042 8:25984889-25984911 TCTCAGTTTCAGGAGGTGGGTGG - Intronic
1038486340 8:27937694-27937716 TCTGAGCTCCAGGGGTTGGCAGG + Intronic
1039213849 8:35245717-35245739 TCTCCGCTGCAGAATGTGGTAGG - Intronic
1040550930 8:48437071-48437093 TCTGAGCTGCTGGGGGTGTGGGG + Intergenic
1041458938 8:58090624-58090646 TTTCAACTGCATGGGGTGGAGGG + Intronic
1041465586 8:58154774-58154796 TCCCATCAGGAGGGGGTGGTAGG + Intronic
1044901486 8:96950470-96950492 TCTCAGCTGAAGGCTGAGGTTGG + Intronic
1045312736 8:101017309-101017331 TCTCTGGTGCATGGGGTGCTGGG + Intergenic
1047305933 8:123652975-123652997 TCTCAGCTGCATGTGCTGGAGGG + Intergenic
1047763057 8:127968362-127968384 GCTCAGCTGTAGGGTGGGGTGGG + Intergenic
1049304747 8:141895198-141895220 GCTCAGCTGTAGGGGTGGGTGGG - Intergenic
1049748836 8:144274148-144274170 TCTCAGCTGGAGCGCGTGGGTGG - Intronic
1049775284 8:144401145-144401167 ACCCAGCTGCAGGGGGAGGGAGG + Intronic
1049783718 8:144440578-144440600 TCCCAGCTGCCGAGGGTGGATGG + Intronic
1049904837 9:206735-206757 CCTCAGCTGCAAGGGATGCTGGG - Intergenic
1050150809 9:2617897-2617919 ACTCAGCTACTGGGGGTGGAGGG - Intergenic
1053203342 9:36167097-36167119 TCCCAGCTACTGGGGGTGGGGGG + Intergenic
1057225138 9:93289176-93289198 GCTCAGGTGCAGGAGGTGGCAGG - Exonic
1057274797 9:93670534-93670556 TCCTGGCTGCAGGGGGTTGTGGG + Intronic
1059443674 9:114325032-114325054 TGTCAGCTGCAGGGGGAGCAAGG - Exonic
1059444874 9:114331809-114331831 TGTCAGCTGCAGGGGGAGCAAGG - Exonic
1060211744 9:121714797-121714819 TTTCATCTGGTGGGGGTGGTGGG + Intronic
1060525150 9:124316219-124316241 TCTCAAGTGCGGGGGCTGGTGGG + Intronic
1060960428 9:127676765-127676787 GCTCAGCTTCCGGGGGAGGTGGG + Intronic
1061087195 9:128405986-128406008 TCTCAGCAGCAGGAGCTGGGTGG + Intergenic
1061320922 9:129828845-129828867 TCTCAGCTGCTGGGGAAGCTGGG - Intronic
1061417329 9:130454208-130454230 TCTCTGTAGCAGGGGGTGGGAGG + Intronic
1061507055 9:131037322-131037344 TCTCAGCTGCGGGTGAGGGTGGG - Intronic
1061636353 9:131912054-131912076 TCTCAGTTCCTCGGGGTGGTAGG - Intronic
1061879296 9:133560735-133560757 TCCCAGCTGGAGGAGGGGGTGGG + Intronic
1061913627 9:133737990-133738012 TCCCAGGCTCAGGGGGTGGTGGG + Intronic
1062278785 9:135742903-135742925 GCCCAGCTGCAGGGGATGCTGGG - Intronic
1062360765 9:136186875-136186897 TCTCACCTGCAGTGTGGGGTCGG - Intergenic
1062454810 9:136630404-136630426 GCTCAGCTCCAGGAGCTGGTGGG - Intergenic
1062560169 9:137138078-137138100 TCTCAGCTCCAGGGGGTCCCTGG + Intergenic
1187024217 X:15417064-15417086 TCCCAGCTACTGGGGGTGGAGGG - Intronic
1187859525 X:23667779-23667801 GCTTAGGTGCAGGGAGTGGTCGG - Exonic
1188465294 X:30472752-30472774 TCCTAGCTGCAGGGGCTGCTGGG + Intergenic
1189467211 X:41286316-41286338 ACTCAGCTGCAGGGGAGGCTGGG + Intergenic
1189576960 X:42364230-42364252 TCTCCTCTGCAGGGGGCAGTTGG + Intergenic
1190744940 X:53316970-53316992 GCTCTGCTGTAGGCGGTGGTGGG - Intronic
1191782855 X:64886912-64886934 CCTCAGCTGCAGGAGATGCTGGG + Intergenic
1193506471 X:82349962-82349984 TCTCTGCTGCTGAGGATGGTGGG - Intergenic
1194706141 X:97178101-97178123 TCCCAGCTGCTGGGGATGGGGGG + Intronic
1195636159 X:107118374-107118396 TCTCAGGTGGAGGTGGAGGTAGG + Intronic
1196978447 X:121185404-121185426 TCACAGCTGCAGGTGGTTTTAGG + Intergenic
1197434841 X:126414086-126414108 TCACACCTGTAGGGGGTGGGGGG + Intergenic
1197709123 X:129653714-129653736 CCTGAGCTGCAGGGAGGGGTCGG + Intronic
1198192366 X:134320850-134320872 TATCAGGTGCTGGGGGTGGGAGG + Intergenic
1198236670 X:134742016-134742038 TCACAGGTGCAGGGGCTGGGTGG + Intronic
1200949504 Y:8880708-8880730 TATCAGATGCTGGGGATGGTAGG + Intergenic
1202029187 Y:20553730-20553752 TTTGAGTTGCAGGGGGTGGGGGG + Intergenic
1202364253 Y:24145402-24145424 TCCCAGCTACTAGGGGTGGTAGG + Intergenic
1202506527 Y:25524720-25524742 TCCCAGCTACTAGGGGTGGTAGG - Intergenic