ID: 1023979668

View in Genome Browser
Species Human (GRCh38)
Location 7:45061349-45061371
Sequence TTCCTTACCCCTAGGTGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023979658_1023979668 23 Left 1023979658 7:45061303-45061325 CCCCTTAGGAGAGACATAAACGA 0: 1
1: 0
2: 1
3: 9
4: 90
Right 1023979668 7:45061349-45061371 TTCCTTACCCCTAGGTGGTTAGG No data
1023979657_1023979668 24 Left 1023979657 7:45061302-45061324 CCCCCTTAGGAGAGACATAAACG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1023979668 7:45061349-45061371 TTCCTTACCCCTAGGTGGTTAGG No data
1023979656_1023979668 27 Left 1023979656 7:45061299-45061321 CCTCCCCCTTAGGAGAGACATAA 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1023979668 7:45061349-45061371 TTCCTTACCCCTAGGTGGTTAGG No data
1023979659_1023979668 22 Left 1023979659 7:45061304-45061326 CCCTTAGGAGAGACATAAACGAT 0: 1
1: 0
2: 0
3: 12
4: 119
Right 1023979668 7:45061349-45061371 TTCCTTACCCCTAGGTGGTTAGG No data
1023979660_1023979668 21 Left 1023979660 7:45061305-45061327 CCTTAGGAGAGACATAAACGATA 0: 1
1: 0
2: 1
3: 6
4: 105
Right 1023979668 7:45061349-45061371 TTCCTTACCCCTAGGTGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023979668 Original CRISPR TTCCTTACCCCTAGGTGGTT AGG Intronic
No off target data available for this crispr