ID: 1023981812

View in Genome Browser
Species Human (GRCh38)
Location 7:45074784-45074806
Sequence GTGTAGGACTTCAAGGCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023981808_1023981812 3 Left 1023981808 7:45074758-45074780 CCAGAGAGGCATGGGTTTTGGTG 0: 1
1: 0
2: 3
3: 158
4: 2924
Right 1023981812 7:45074784-45074806 GTGTAGGACTTCAAGGCGGAAGG 0: 1
1: 0
2: 0
3: 5
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023981812 Original CRISPR GTGTAGGACTTCAAGGCGGA AGG Intronic
901791978 1:11658552-11658574 GTGGTGGACCTCAAGGCCGAAGG + Exonic
901909939 1:12448524-12448546 GTGTAGGACTTTTTGGCAGAAGG - Intronic
905583292 1:39098466-39098488 GTGTAGCACTTCAAGGTTCACGG + Intronic
907480749 1:54744101-54744123 GTGTAGGACTTCCTGGAGAAGGG + Intergenic
916967663 1:169968231-169968253 ATGTAGGACTTCAAAAAGGATGG - Intronic
922218148 1:223537697-223537719 GTGTAGGACCTTATGGGGGATGG - Intergenic
922882277 1:228990006-228990028 CTGGAGGACTTCATGGCGGCAGG - Intergenic
923084530 1:230693436-230693458 GAGTTGGACTTCCAGGCTGAAGG + Exonic
1068564214 10:58553374-58553396 TTGTTGGACTTCAAGATGGAAGG + Intronic
1070129560 10:73647281-73647303 GAGAAGGACTTCTAGGCCGAGGG + Exonic
1070784103 10:79153258-79153280 GTGATGGACTACAAGGAGGAGGG - Intronic
1072044726 10:91643519-91643541 GTGAAGGACTTCCAGGGAGATGG - Intergenic
1074864215 10:117535560-117535582 GTTTAGGACTGGAAGGCGGAGGG - Intergenic
1075514572 10:123098888-123098910 GTGAAGGACTCCAAGGTAGAGGG - Intergenic
1077414320 11:2417771-2417793 GTGTATGACTTCGAGCAGGAGGG - Exonic
1083230095 11:61311829-61311851 GTCTTGGACTTCAATGCGGCTGG + Exonic
1083893856 11:65610650-65610672 GTGTTGGTCTTCAAAGGGGAAGG - Intronic
1084525220 11:69693287-69693309 GTTTAGGAGGTCAAGGTGGAAGG + Intergenic
1084738703 11:71123476-71123498 GGGTAGGACTTCCAGGTTGAGGG + Intronic
1089849231 11:121482129-121482151 GTTTTGGACTTGAAGGAGGAGGG + Intronic
1096826630 12:54283542-54283564 GTGAAGGCCTTCAAGGCTGAAGG + Intronic
1097337922 12:58405533-58405555 ATGTAGGACTCAAAGGTGGAAGG + Intergenic
1103695494 12:122812197-122812219 CTGTGGGAGTTCGAGGCGGATGG + Intronic
1106127069 13:26909334-26909356 GTGTATGTCTTCAATGTGGAAGG + Intergenic
1106995427 13:35475519-35475541 GTGGCGGAGGTCAAGGCGGAAGG - Exonic
1115159285 14:30375044-30375066 GTGCAGGACTTCAAGGCTGTAGG + Intergenic
1120290917 14:82569757-82569779 GAGTAGGATTTTAAGGAGGATGG - Intergenic
1120788988 14:88562367-88562389 GTGTGAGAATTCAAGGCTGATGG + Intergenic
1121841710 14:97139850-97139872 CTGTAGGCCTTCAAGGCCCAGGG + Intergenic
1122534411 14:102452217-102452239 GTGTAGCACTTTAAGGTAGAAGG - Intronic
1122552858 14:102559441-102559463 GTGTAGGAATTTAAAGCTGAAGG - Intergenic
1134031810 16:10998171-10998193 GTGAAGGGGTTCAAGGCTGATGG + Intronic
1138588575 16:57986926-57986948 GGGGAAGACTTCAAGGAGGATGG - Intronic
1139764479 16:69215322-69215344 CTGTAGGAATTCAAGGCTGTAGG + Intronic
1141475405 16:84269772-84269794 GTGTATAACTTCAAGGCCGGTGG - Intergenic
1142283462 16:89161098-89161120 GTGGAGGACTCGGAGGCGGAGGG + Intergenic
1144953455 17:19005771-19005793 GTGTAGGACTTCATGCTTGAGGG - Intronic
1148719036 17:49737522-49737544 GAGTAGGACTCCAAGGCTGAGGG + Intronic
1149974920 17:61255872-61255894 GGGCTGGACTTCAAGGTGGATGG + Intronic
1153364862 18:4244210-4244232 ACGTAGGACTTGAAGGGGGAAGG - Intronic
1157414534 18:47490846-47490868 GTGGAGGATGTCAAGGGGGAAGG - Intergenic
1162320608 19:9969075-9969097 GTGTAGACCATCAAGGTGGAAGG + Intronic
1162360704 19:10218510-10218532 GTGTAGGCATTCCAGGCAGAGGG + Intronic
1166150071 19:40866339-40866361 GTCTAGGAGTTCAAGGCTGCAGG + Intronic
929431566 2:41892053-41892075 GTGAGGGATTTCCAGGCGGAAGG + Intergenic
934301850 2:91781131-91781153 GTGAAGGACATCCAGGCGGCTGG + Intergenic
935974502 2:108564570-108564592 GTGTTGCACTTCAAGTCTGAAGG + Intronic
943044222 2:182839401-182839423 GTGTCTGACTTCAAAGCAGATGG - Intronic
948826225 2:240574542-240574564 GTGCAGGGCGTCCAGGCGGAAGG - Exonic
1173454624 20:43192208-43192230 GTGCAGGGCTTCCAGGCAGAGGG - Intergenic
1174139909 20:48405629-48405651 GTGTATGAGCTCAAGGAGGAAGG - Intergenic
1180676021 22:17587165-17587187 GTGTAGGACCTGGAGGTGGAGGG - Exonic
1180814579 22:18781588-18781610 GTGAAGGACATCCAGGCGGCTGG - Intergenic
1181036164 22:20170684-20170706 AGGTAGAACATCAAGGCGGAAGG + Intergenic
1181200767 22:21215924-21215946 GTGAAGGACATCCAGGCGGCTGG - Exonic
1181700972 22:24621049-24621071 GTGAAGGACATCCAGGCGGCCGG + Exonic
1182911590 22:33989056-33989078 GAGTTGAACCTCAAGGCGGAGGG - Intergenic
1203226149 22_KI270731v1_random:79511-79533 GTGAAGGACATCCAGGCGGCTGG + Intergenic
1203264679 22_KI270734v1_random:7275-7297 GTGAAGGACATCCAGGCGGCTGG - Intergenic
951322185 3:21258549-21258571 GTTTATGACTTGAAGGAGGATGG + Intergenic
951603950 3:24410921-24410943 GTGTAGGAATATAATGCGGATGG + Intronic
953025474 3:39142491-39142513 GTGTAGGACTACAAGGCAAAAGG + Exonic
953458083 3:43059913-43059935 GTGTAGGTCTACCAGGCAGAAGG - Intronic
959040939 3:101422988-101423010 ATGTAGGACTCCAAGTCTGAGGG - Intronic
960680472 3:120242607-120242629 GAGGAGGACTTCCAGGCAGAGGG + Intronic
961811929 3:129527043-129527065 GGGAAGGACATCCAGGCGGAAGG - Intergenic
973142685 4:46788012-46788034 GTTTAGGACTTCAGGGACGAAGG + Intronic
974918470 4:68206296-68206318 GTCTCGGACTTCCAGGCTGAGGG - Intergenic
981621939 4:146710641-146710663 CTGTAGGACTTCAAGGGAGCTGG + Intronic
992740929 5:79772737-79772759 ATGTAAGAGTTCAAGACGGAAGG + Intronic
998881266 5:146647681-146647703 CTCTAGGCCTTCAAGGGGGAGGG - Intronic
1005298624 6:24449847-24449869 GTGTTGGACTTTAACGTGGACGG - Exonic
1008660378 6:53661591-53661613 GTGCTGGGCTTCAAGGCTGATGG + Intronic
1012599280 6:101074378-101074400 GAGTAGTACTTGAAGGCAGATGG - Intergenic
1023319399 7:38976451-38976473 GGGTAGGACTTCAGCGCAGACGG + Intergenic
1023981812 7:45074784-45074806 GTGTAGGACTTCAAGGCGGAAGG + Intronic
1029643080 7:101833303-101833325 CTTTAGGAGGTCAAGGCGGAAGG + Intronic
1037281850 8:17250056-17250078 GTGAGGGTCTTCAGGGCGGAAGG + Intronic
1040978498 8:53220591-53220613 GTGTGGGGTTGCAAGGCGGATGG + Intergenic
1041448752 8:57984452-57984474 TTGTAAGACTTCAAGGCACAGGG + Intergenic
1049309511 8:141925886-141925908 ATCTAGGACTTCCAGGAGGAGGG + Intergenic
1050980598 9:12008863-12008885 CTGTAGAACTGCAAGGTGGAAGG + Intergenic
1052882174 9:33608305-33608327 GGGTAGCAATTCAAGGCAGAGGG - Intergenic
1053244526 9:36523700-36523722 CTGTAGGAGGTCAAGGCGGGTGG - Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1062174700 9:135154699-135154721 GTGTAGGACTCAAAGGGGAAGGG + Intergenic
1189393729 X:40601784-40601806 GTGTGGGACTTGGAGTCGGAAGG + Intronic
1190010459 X:46780302-46780324 GGGTATGACTTCAAGGGAGATGG - Intergenic
1193119965 X:77813025-77813047 CTTTAGGACGCCAAGGCGGATGG - Intergenic