ID: 1023986363

View in Genome Browser
Species Human (GRCh38)
Location 7:45099458-45099480
Sequence GTCTCTAAGGAGAGGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023986354_1023986363 19 Left 1023986354 7:45099416-45099438 CCAGTTCCCTGACTGCTATTTAG No data
Right 1023986363 7:45099458-45099480 GTCTCTAAGGAGAGGCTGGAAGG No data
1023986353_1023986363 20 Left 1023986353 7:45099415-45099437 CCCAGTTCCCTGACTGCTATTTA No data
Right 1023986363 7:45099458-45099480 GTCTCTAAGGAGAGGCTGGAAGG No data
1023986356_1023986363 13 Left 1023986356 7:45099422-45099444 CCCTGACTGCTATTTAGTCAGGT No data
Right 1023986363 7:45099458-45099480 GTCTCTAAGGAGAGGCTGGAAGG No data
1023986357_1023986363 12 Left 1023986357 7:45099423-45099445 CCTGACTGCTATTTAGTCAGGTT No data
Right 1023986363 7:45099458-45099480 GTCTCTAAGGAGAGGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023986363 Original CRISPR GTCTCTAAGGAGAGGCTGGA AGG Intergenic
No off target data available for this crispr