ID: 1023987650

View in Genome Browser
Species Human (GRCh38)
Location 7:45106230-45106252
Sequence TGCAAGCAAGAACTCTAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023987650 Original CRISPR TGCAAGCAAGAACTCTAGAG TGG Intronic
903396890 1:23008354-23008376 TGAAAGCTAGATCTCTGGAGAGG - Intergenic
904432903 1:30476676-30476698 TGCACGCACCAACTCTTGAGAGG + Intergenic
905854467 1:41299186-41299208 TGCAATACAGAACTTTAGAGAGG - Intergenic
908635621 1:66160906-66160928 CTCCAGCAATAACTCTAGAGTGG + Intronic
909257277 1:73439574-73439596 TGCAAGTCAGAAATCTAGTGGGG - Intergenic
916705526 1:167345367-167345389 TGTAAGAAAGCAGTCTAGAGAGG + Intronic
919318944 1:196009419-196009441 TCCAAGGAAGAACTATTGAGAGG - Intergenic
1065850854 10:29786875-29786897 TACAAGAAAGAATTTTAGAGCGG + Intergenic
1071905319 10:90167319-90167341 TGAAAGCAAGAAGTGTGGAGGGG + Intergenic
1077422605 11:2460093-2460115 TGCAAGCAAGGACTCGAGTGAGG - Intronic
1078010860 11:7572152-7572174 TGCAGTCAAGAAGTCTGGAGAGG - Intronic
1079195465 11:18322714-18322736 TGGAAGCTACAACTCTAGACAGG - Exonic
1081335413 11:41859705-41859727 TGGAAGCAAGAAGTTTAAAGTGG - Intergenic
1084412453 11:69012676-69012698 TTCAAGCATGCATTCTAGAGGGG - Intronic
1088741379 11:112770186-112770208 TGCAAGCAGGCCCTCTAAAGTGG + Intergenic
1091482289 12:845376-845398 TGAAAACCAGAAATCTAGAGTGG - Intronic
1096851308 12:54439585-54439607 TGACATCAAGAACTCTACAGTGG - Intergenic
1099684688 12:85869522-85869544 TGAAATGAAAAACTCTAGAGGGG + Intergenic
1099757407 12:86870761-86870783 TGCAAGGAAGAACTCAGGAGAGG + Intergenic
1100819563 12:98418788-98418810 TTCATGGAAGAACTCTAGACAGG - Intergenic
1101334190 12:103781768-103781790 TGAAACCATGCACTCTAGAGTGG + Intronic
1102679328 12:114680067-114680089 TGAAAGGCTGAACTCTAGAGAGG + Intronic
1113558893 13:111261170-111261192 TGCAATCAAGAGCCGTAGAGTGG + Intronic
1115428292 14:33286601-33286623 AGCAAGAAACAACACTAGAGAGG - Intronic
1115819023 14:37194127-37194149 TGCAAGGAAGCATTCTAGACTGG - Intergenic
1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG + Intergenic
1117339092 14:54778719-54778741 TGCAATCAGGAAATTTAGAGCGG - Intronic
1118599191 14:67459512-67459534 TGAAAGCAAGAACTTTAAATAGG - Intronic
1120700133 14:87690493-87690515 TCAAAGCAAATACTCTAGAGGGG - Intergenic
1124165999 15:27326227-27326249 TACAACAAAGAACTGTAGAGAGG - Intronic
1125399544 15:39286083-39286105 AGTAAGGAAGCACTCTAGAGAGG - Intergenic
1126155248 15:45559837-45559859 TGCAACCAGGAATTCAAGAGTGG - Intergenic
1132983079 16:2749236-2749258 TGCAAGCAGGGTCTCTTGAGAGG - Intergenic
1137998058 16:53241745-53241767 TGCAAGCAAGAAATCTTCATTGG - Intronic
1140239068 16:73184641-73184663 TGCAAGCAAGAACCCCACACTGG - Intergenic
1145720195 17:27064232-27064254 TGAAAGCATAGACTCTAGAGTGG - Intergenic
1145844365 17:28025084-28025106 TGCAAGCAAACACTCCAGAGAGG + Intergenic
1146535868 17:33651628-33651650 TGCGAGCATGGGCTCTAGAGGGG - Intronic
1147198362 17:38782683-38782705 TGCATGCAAGCCCTCCAGAGAGG + Intronic
1148431142 17:47644638-47644660 TGCAAGCCAGAAATCTAGTAGGG + Intergenic
1150319484 17:64200475-64200497 AGCCAGCAAGAACTCCACAGTGG - Intronic
1152174675 17:78780027-78780049 AGCAGGCAAGAACACAAGAGAGG + Intronic
1155349837 18:24895716-24895738 TGGAAGCAAGAACTGCAGTGTGG - Intergenic
1158325879 18:56313709-56313731 TGCAGGGAAGAACTCCGGAGAGG - Intergenic
1160105149 18:75966766-75966788 TGGAAGCAAGCACTGTAAAGAGG + Intergenic
1163984286 19:20930176-20930198 TGTGAGCATGAACTCTAGAAAGG - Intronic
1167713805 19:51128039-51128061 TGTAAGCATGGACCCTAGAGAGG + Exonic
930629740 2:53739342-53739364 TGAAAGCAAGAACTCAAAACGGG + Intronic
932458682 2:71867052-71867074 AGCAATAAAGAACTCAAGAGAGG - Intergenic
932961969 2:76423146-76423168 TCCCAGCAAGAACTCTTTAGTGG + Intergenic
933901911 2:86856153-86856175 TGCAAGCCAGAGCTGGAGAGAGG + Intronic
935513507 2:104005564-104005586 TGAAAACAAGAACTCTAAAATGG - Intergenic
936468843 2:112779380-112779402 TGCAACCCAGAACTCTGAAGAGG + Intronic
937660154 2:124421579-124421601 TGGAAGCAGGAACTCCAGACAGG - Intronic
938584587 2:132677356-132677378 TTCAAGCAAGAAGTGTATAGTGG + Intronic
938899112 2:135783932-135783954 TGGAAGATAGCACTCTAGAGTGG + Exonic
939455387 2:142428168-142428190 TGCCACCAAGAACTCTATAATGG - Intergenic
939790533 2:146568866-146568888 TGGAAGCAAGAACTCAGGAGGGG + Intergenic
944682110 2:202086516-202086538 TGAAAGAAAGAATTATAGAGAGG - Intronic
945883705 2:215352821-215352843 TGCAAGAAAAAAATCTAAAGAGG - Intergenic
946797306 2:223369568-223369590 GGCAAGCAAGAACTGAAGAGAGG + Intergenic
948897661 2:240934798-240934820 TGCAAGCCAGAGCTCTTGGGCGG - Intronic
1170329671 20:15194809-15194831 TGCAAACAGTAACTCTGGAGTGG - Intronic
1170391255 20:15877171-15877193 TGCAAGCAAGTACACCAGAGAGG - Intronic
1170625929 20:18030166-18030188 TGCAAACATGAAAGCTAGAGCGG - Intronic
1171103057 20:22404290-22404312 TGGAGGCAAGAAGTCTAGTGTGG + Intergenic
1172882785 20:38212718-38212740 TGCGAGCGAGACCTCTGGAGGGG + Exonic
1173088344 20:39946524-39946546 AGCAAGCAAAAACTAAAGAGAGG + Intergenic
1173450379 20:43158396-43158418 TGGAGGCAAGAGCTCTGGAGAGG + Intronic
1174167620 20:48596339-48596361 TGTAAGCAGGAACTGTAGGGAGG + Intergenic
1174874322 20:54210559-54210581 TAGAAGGCAGAACTCTAGAGAGG - Intronic
1177306585 21:19326293-19326315 TGAAAGCAAGAACTGCAGAGAGG - Intergenic
1177839358 21:26218709-26218731 TGCAAGTCTGAAATCTAGAGGGG - Intergenic
1181152539 22:20895443-20895465 TCCAAGCAAGAATTGAAGAGGGG + Intergenic
1181406259 22:22686957-22686979 TGCAAGGAAGAACAAGAGAGGGG - Intergenic
1181414207 22:22747597-22747619 TGCAAGGAAGAACAAGAGAGGGG - Intronic
1184004274 22:41697184-41697206 TACAAGCCAGAGCTCTGGAGAGG + Exonic
949669686 3:6384902-6384924 TGCAAGATAGAATACTAGAGAGG + Intergenic
951559975 3:23956092-23956114 CGCAAGCATGAACTCCATAGTGG - Exonic
952164632 3:30733668-30733690 AGCAAGCAAGCAATCAAGAGAGG - Intronic
952669827 3:35953332-35953354 TGCCAGCAAAATCTCTAGTGAGG + Intergenic
954072341 3:48152027-48152049 TGCAAGCAGGAACTCTGGACTGG + Intergenic
960486286 3:118256890-118256912 AGCAAGGAATAAATCTAGAGGGG + Intergenic
961244674 3:125440862-125440884 TCTAGGAAAGAACTCTAGAGGGG + Intergenic
963324860 3:143851551-143851573 TGAAAGAAAGAACTGAAGAGTGG + Intergenic
964104838 3:153028005-153028027 TTCATGCAGGATCTCTAGAGAGG + Intergenic
964196531 3:154071296-154071318 TAGAAGCAGGAACTCAAGAGGGG - Intergenic
964498948 3:157327048-157327070 TCCAAGCCAGGACTCAAGAGGGG + Intronic
966678602 3:182616505-182616527 TTAAAGCCAGGACTCTAGAGGGG - Intergenic
967748187 3:193083311-193083333 TGGAAGTATGAACTCAAGAGTGG + Intergenic
969064349 4:4466585-4466607 TGCACTGAAGCACTCTAGAGCGG + Intronic
969251264 4:5970262-5970284 CGGAATTAAGAACTCTAGAGAGG + Intronic
969446724 4:7249131-7249153 AGCAAGCAAGAACTATTCAGGGG - Intronic
972864723 4:43216872-43216894 TGTAGGCATGAACTCTAGAAAGG + Intergenic
974982227 4:68972817-68972839 TACAAGCAATAGCTCTTGAGTGG + Intergenic
978604836 4:110467960-110467982 TGAAAGCAAGAAGTGGAGAGAGG - Intronic
979154202 4:117361479-117361501 TGTAAGTAAGAATTCTAGAAGGG - Intergenic
979987786 4:127336742-127336764 TACAAGGAAGAACTATGGAGAGG - Intergenic
980376539 4:131957128-131957150 TGCAAGTCAGAAATCCAGAGGGG + Intergenic
981246383 4:142544654-142544676 TGGAAGCAGCAACTCCAGAGAGG + Intronic
983436652 4:167724156-167724178 TGCAGGAAAGCACTCTAAAGTGG - Intergenic
990034054 5:51298100-51298122 TGCAAGCACGAAGCCTAGAAAGG + Intergenic
992189605 5:74278368-74278390 AGCAAGCAAGAACAATGGAGGGG - Intergenic
993117588 5:83735915-83735937 TGCAAGTCAGAAATCCAGAGGGG - Intergenic
995470471 5:112496504-112496526 TGCAAGAAAGAATACCAGAGAGG + Intergenic
1003333095 6:5145863-5145885 GGAATGCAGGAACTCTAGAGGGG - Intronic
1008518743 6:52343262-52343284 GGAAAGCAAGACCTCTAGTGTGG - Intergenic
1009198430 6:60715094-60715116 AGCAACTAAGAAGTCTAGAGAGG - Intergenic
1012224214 6:96686424-96686446 TGCAAGTCAGAAATCCAGAGGGG - Intergenic
1018845902 6:167555287-167555309 TGCAAGCAATTATTTTAGAGAGG + Intergenic
1023987650 7:45106230-45106252 TGCAAGCAAGAACTCTAGAGTGG + Intronic
1030378558 7:108783470-108783492 TGCAAGGATGAAGCCTAGAGAGG + Intergenic
1030718381 7:112838462-112838484 TGCAAAAAAGAAATCTAGAAAGG + Intronic
1030868820 7:114731933-114731955 TGCAAGTCTGAAATCTAGAGGGG - Intergenic
1033800996 7:144902145-144902167 GCCAAACAAGCACTCTAGAGAGG + Intergenic
1036600523 8:10256463-10256485 TTAATGCAAGAACTCTGGAGTGG + Intronic
1037430847 8:18811730-18811752 GGCAAGCAAGAAAGCCAGAGTGG + Intronic
1041633728 8:60118586-60118608 TGGAAGCAAGTACTCTAGACAGG + Intergenic
1046843980 8:118894799-118894821 GGCAAGCAAGGACACTGGAGAGG - Intergenic
1047138547 8:122108548-122108570 TGGATGCAAGGACTTTAGAGTGG + Intergenic
1047905095 8:129464487-129464509 TGGAAGGAAGAGCTCTATAGAGG + Intergenic
1049274957 8:141715613-141715635 TGGTAGCAAGAACCCTGGAGTGG - Intergenic
1050844406 9:10196027-10196049 GGCAAGAAAGAACTCTACGGGGG + Intronic
1051261939 9:15273092-15273114 TGCATGCAAGAACATTTGAGTGG + Intronic
1052464414 9:28812172-28812194 TGGAAGCAGGAACTAAAGAGAGG + Intergenic
1059031067 9:110696842-110696864 TGCAAGGATGAACTGTATAGTGG + Intronic
1060812334 9:126616801-126616823 TGCAGGCCAGAGCCCTAGAGAGG + Intronic
1189178499 X:38981581-38981603 TGAAATCAGAAACTCTAGAGTGG - Intergenic
1189474892 X:41344247-41344269 CGCAAGGACGAACTCTAGATCGG - Exonic
1190808033 X:53857991-53858013 TCCAATCAAAAACTATAGAGTGG - Intergenic
1192562049 X:72133643-72133665 TCCAAGAAAGAACTCCAGATTGG + Intronic
1192747307 X:73951884-73951906 TATATGCAAAAACTCTAGAGAGG + Intergenic
1193411316 X:81166794-81166816 TGCAAAGAAGAACTTTAGAAAGG + Intronic
1196247844 X:113421746-113421768 GGCAAGCAGGAACCCAAGAGTGG - Intergenic
1197055800 X:122116826-122116848 TCCAAGCAATAACACTAGAGTGG + Intergenic
1198882461 X:141295868-141295890 TGAAAGTGAGAACTCCAGAGAGG + Intergenic
1199446885 X:147934811-147934833 TGCAAGGCAGATCTTTAGAGAGG + Intronic
1200182488 X:154159261-154159283 GGCAAGCAAGAGCTGTGGAGGGG + Intergenic
1200188142 X:154196375-154196397 GGCAAGCAAGAGCTGTGGAGGGG + Intergenic
1200193792 X:154233515-154233537 GGCAAGCAAGAGCTGTGGAGGGG + Intergenic
1200199547 X:154271319-154271341 GGCAAGCAAGAGCTGTGGAGGGG + Exonic