ID: 1023989081

View in Genome Browser
Species Human (GRCh38)
Location 7:45117451-45117473
Sequence GGGTCTTTTGCACCCCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023989072_1023989081 15 Left 1023989072 7:45117413-45117435 CCTGCCCGGGGCTCTGTCCCAGC No data
Right 1023989081 7:45117451-45117473 GGGTCTTTTGCACCCCCAGCAGG No data
1023989066_1023989081 29 Left 1023989066 7:45117399-45117421 CCCCTGCTTCTGTGCCTGCCCGG No data
Right 1023989081 7:45117451-45117473 GGGTCTTTTGCACCCCCAGCAGG No data
1023989074_1023989081 11 Left 1023989074 7:45117417-45117439 CCCGGGGCTCTGTCCCAGCTGGA No data
Right 1023989081 7:45117451-45117473 GGGTCTTTTGCACCCCCAGCAGG No data
1023989068_1023989081 28 Left 1023989068 7:45117400-45117422 CCCTGCTTCTGTGCCTGCCCGGG No data
Right 1023989081 7:45117451-45117473 GGGTCTTTTGCACCCCCAGCAGG No data
1023989079_1023989081 -3 Left 1023989079 7:45117431-45117453 CCAGCTGGACTCAGAGTGGTGGG No data
Right 1023989081 7:45117451-45117473 GGGTCTTTTGCACCCCCAGCAGG No data
1023989065_1023989081 30 Left 1023989065 7:45117398-45117420 CCCCCTGCTTCTGTGCCTGCCCG No data
Right 1023989081 7:45117451-45117473 GGGTCTTTTGCACCCCCAGCAGG No data
1023989070_1023989081 27 Left 1023989070 7:45117401-45117423 CCTGCTTCTGTGCCTGCCCGGGG No data
Right 1023989081 7:45117451-45117473 GGGTCTTTTGCACCCCCAGCAGG No data
1023989077_1023989081 -2 Left 1023989077 7:45117430-45117452 CCCAGCTGGACTCAGAGTGGTGG No data
Right 1023989081 7:45117451-45117473 GGGTCTTTTGCACCCCCAGCAGG No data
1023989075_1023989081 10 Left 1023989075 7:45117418-45117440 CCGGGGCTCTGTCCCAGCTGGAC No data
Right 1023989081 7:45117451-45117473 GGGTCTTTTGCACCCCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023989081 Original CRISPR GGGTCTTTTGCACCCCCAGC AGG Intergenic
No off target data available for this crispr