ID: 1023991244

View in Genome Browser
Species Human (GRCh38)
Location 7:45130084-45130106
Sequence CTGGCCAGGCAGAGGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023991244_1023991251 7 Left 1023991244 7:45130084-45130106 CCAGCCACCCTCTGCCTGGCCAG No data
Right 1023991251 7:45130114-45130136 CTTCCGATGAGTTCACTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023991244 Original CRISPR CTGGCCAGGCAGAGGGTGGC TGG (reversed) Intergenic
No off target data available for this crispr