ID: 1023991244 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:45130084-45130106 |
Sequence | CTGGCCAGGCAGAGGGTGGC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1023991244_1023991251 | 7 | Left | 1023991244 | 7:45130084-45130106 | CCAGCCACCCTCTGCCTGGCCAG | No data | ||
Right | 1023991251 | 7:45130114-45130136 | CTTCCGATGAGTTCACTCTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1023991244 | Original CRISPR | CTGGCCAGGCAGAGGGTGGC TGG (reversed) | Intergenic | ||
No off target data available for this crispr |