ID: 1023991879

View in Genome Browser
Species Human (GRCh38)
Location 7:45133394-45133416
Sequence CTGAGTAAAGACAGGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023991869_1023991879 26 Left 1023991869 7:45133345-45133367 CCACTCCTGGTCCTATGGGGTCA No data
Right 1023991879 7:45133394-45133416 CTGAGTAAAGACAGGGATGGAGG No data
1023991868_1023991879 27 Left 1023991868 7:45133344-45133366 CCCACTCCTGGTCCTATGGGGTC No data
Right 1023991879 7:45133394-45133416 CTGAGTAAAGACAGGGATGGAGG No data
1023991867_1023991879 28 Left 1023991867 7:45133343-45133365 CCCCACTCCTGGTCCTATGGGGT No data
Right 1023991879 7:45133394-45133416 CTGAGTAAAGACAGGGATGGAGG No data
1023991870_1023991879 21 Left 1023991870 7:45133350-45133372 CCTGGTCCTATGGGGTCAGCTGG No data
Right 1023991879 7:45133394-45133416 CTGAGTAAAGACAGGGATGGAGG No data
1023991873_1023991879 15 Left 1023991873 7:45133356-45133378 CCTATGGGGTCAGCTGGGTCAGG No data
Right 1023991879 7:45133394-45133416 CTGAGTAAAGACAGGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023991879 Original CRISPR CTGAGTAAAGACAGGGATGG AGG Intergenic
No off target data available for this crispr