ID: 1023996457

View in Genome Browser
Species Human (GRCh38)
Location 7:45161815-45161837
Sequence GTCCAGGTGGACCAGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023996448_1023996457 18 Left 1023996448 7:45161774-45161796 CCAAGTGGTCCAGGTCTAGGGGT 0: 1
1: 0
2: 1
3: 3
4: 114
Right 1023996457 7:45161815-45161837 GTCCAGGTGGACCAGGCTGCAGG No data
1023996444_1023996457 23 Left 1023996444 7:45161769-45161791 CCAGGCCAAGTGGTCCAGGTCTA 0: 1
1: 0
2: 0
3: 19
4: 182
Right 1023996457 7:45161815-45161837 GTCCAGGTGGACCAGGCTGCAGG No data
1023996449_1023996457 9 Left 1023996449 7:45161783-45161805 CCAGGTCTAGGGGTTCAGATTCA 0: 1
1: 0
2: 1
3: 7
4: 122
Right 1023996457 7:45161815-45161837 GTCCAGGTGGACCAGGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023996457 Original CRISPR GTCCAGGTGGACCAGGCTGC AGG Intronic
No off target data available for this crispr