ID: 1023996708

View in Genome Browser
Species Human (GRCh38)
Location 7:45162969-45162991
Sequence GGCCTCCAAGCCTGCTGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023996704_1023996708 21 Left 1023996704 7:45162925-45162947 CCTGCAGAAGGGGCTTGCCTGGA 0: 1
1: 0
2: 1
3: 27
4: 203
Right 1023996708 7:45162969-45162991 GGCCTCCAAGCCTGCTGGACTGG 0: 1
1: 0
2: 1
3: 17
4: 199
1023996702_1023996708 28 Left 1023996702 7:45162918-45162940 CCTCGGACCTGCAGAAGGGGCTT No data
Right 1023996708 7:45162969-45162991 GGCCTCCAAGCCTGCTGGACTGG 0: 1
1: 0
2: 1
3: 17
4: 199
1023996705_1023996708 4 Left 1023996705 7:45162942-45162964 CCTGGAGCTTGCAGAGATGAGTG 0: 1
1: 0
2: 1
3: 19
4: 277
Right 1023996708 7:45162969-45162991 GGCCTCCAAGCCTGCTGGACTGG 0: 1
1: 0
2: 1
3: 17
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023996708 Original CRISPR GGCCTCCAAGCCTGCTGGAC TGG Intronic